View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_196 (Length: 202)
Name: NF1145_low_196
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_196 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 39249991 - 39250103
Alignment:
| Q |
1 |
atataacctttcttgtattggttgggtcaatagattataatagggttggaggggtcaatttctttttcttctcttgaaaaattgtatgaagaatagttta |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39249991 |
atataacctttcttgtattggctgggtcaatagattataatagggttggaggggtcaatttctttttcttctcttgaaaaattgtataaagaatagttta |
39250090 |
T |
|
| Q |
101 |
actttatttagat |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39250091 |
actttatttagat |
39250103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University