View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_62 (Length: 408)
Name: NF1145_low_62
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 140 - 399
Target Start/End: Original strand, 13809923 - 13810182
Alignment:
| Q |
140 |
gttttctattacacggcccaacccaatttcaagtgacctctccaattgttgtaattcttccacattcaaaccttcaagatcttctcccctcatctgcctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13809923 |
gttttctattacacggcccaacccaatttcaagtgacctctccaattgttgtaattcttccacattcaaaccttcaagatcttctcccctcatctgcctt |
13810022 |
T |
|
| Q |
240 |
agttgacgactcttcttagaaacttccttgctcaatctagaacagttgctgttttcaactagctgcagattaaatttaagcatcaaaatctgcttcaaca |
339 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13810023 |
agttgatgactcttcttagaaacttccatgctcaatctagaacagttgctgttttcaactagctgcagattaaatttaagcatcaaaatctgtttcaaca |
13810122 |
T |
|
| Q |
340 |
ataatgaacttgtgattttgttttagcagtgaccatcatcaatgttttatttgttcattt |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13810123 |
ataatgaacttgtgattttgttttagcagtgaccatcatcaatgttttatttgttcattt |
13810182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 142 - 307
Target Start/End: Complemental strand, 13962351 - 13962186
Alignment:
| Q |
142 |
tttctattacacggcccaacccaatttcaagtgacctctccaattgttgtaattcttccacattcaaaccttcaagatcttctcccctcatctgccttag |
241 |
Q |
| |
|
|||| |||||||||||||| ||||||||||| ||| |||||||||||||||| ||||||| | ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
13962351 |
tttcaattacacggcccaatccaatttcaagagacttctccaattgttgtaactcttccagactcaaaccttggagatcctctcccctcatctgccttag |
13962252 |
T |
|
| Q |
242 |
ttgacgactcttcttagaaacttccttgctcaatctagaacagttgctgttttcaactagctgcag |
307 |
Q |
| |
|
|||| | ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13962251 |
ttgatggctcttctgagcaacttccttgctcaatctagaacagttgctgttttcaactagctgcag |
13962186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University