View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_63 (Length: 408)
Name: NF1145_low_63
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 1 - 379
Target Start/End: Complemental strand, 7364779 - 7364398
Alignment:
| Q |
1 |
agccggccaaaaagtgaagatgattaaagaatggtaagaattgatataaaggtgaaaaagtatggtatagaaaagagattctgtggaatggaagtaaggt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364779 |
agccggccaaaaagtgaagaggattaaagaatggtaagaattgatataaaggtgaaaaagtatggtatagaaaagagattctgtggaatggaagtaaggt |
7364680 |
T |
 |
| Q |
101 |
atattttcttgcttttttggtgtgttcatacttcattttgcattgcatatactctaatagtgattatgtaggagctttaggtgtaatcaatga---nnnn |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364679 |
atattttcttgcttttttggtgtgttcatacttcattttgcattgcatatactctaatagtgattatgtaggagctttaggtgtaatcaatgattttttt |
7364580 |
T |
 |
| Q |
198 |
nnnnnnnnnnnnnnatgaaataggtgtaatcaatgtttttgtgcttggatatagctgtaatcaaaatcaccagcattataagtagcaatgattttcatca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364579 |
ttttgtttatttttatgaaataggtgtaatcaatgtttttgtgcttggatatagctgtaatcaaaatcaccagcattataagtagcaatgattttcatca |
7364480 |
T |
 |
| Q |
298 |
ctttttgacaattgagacacatcttagaaatgggatggtttattgcattggctatgattgtagtctaagattacaatattta |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364479 |
ctttttgacaattgagacacatcttagaaatgggatggtttattgcattggctatgattgtagtctaagattacaatattta |
7364398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University