View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_68 (Length: 388)
Name: NF1145_low_68
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 122 - 360
Target Start/End: Original strand, 42035011 - 42035249
Alignment:
| Q |
122 |
tgagagaggaagtgctagcggttactggatggtgataagcttgtaaatgcatggttttactgtgtaattagtattgatttcacagatactttgtattgag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42035011 |
tgagagaggaagtgctagcggttactggatggtgataaacttgtaattgcatggttttactgtgtaattagtattgatttcacagatactttgtactgag |
42035110 |
T |
 |
| Q |
222 |
taccaatctcttttgctagggtggtgattatctaaaataaatagtttttagaaggatggttttttgagggaattagaatatgattgaagtcgcccaatag |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42035111 |
taccaatctcttttgctagggtggtgattatctaaaataaatagtttttagaaggatggttttttgaggtaattagaatatgattgaagtcgcccaatag |
42035210 |
T |
 |
| Q |
322 |
catcacaattggacaattcgagacctcaagtcacaaaat |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42035211 |
catcacaattggacaattcgagacctcaagtcacaaaat |
42035249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 91
Target Start/End: Original strand, 42034944 - 42035012
Alignment:
| Q |
19 |
tcgaagaatatttaaaactatatgatttcatgctcataattaagagcctgatagacttcctgatttacaactg |
91 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42034944 |
tcgaaaaacatttaaaactatatgatttcatgctcataa----gagcctgatagacttcctgatttacaactg |
42035012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University