View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_71 (Length: 381)
Name: NF1145_low_71
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 4e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 142 - 355
Target Start/End: Original strand, 676018 - 676220
Alignment:
| Q |
142 |
gcatggagagtgattgagtatgagttgatagactataggtcatagtcaaggtgttgttttggatttgtgtgctgatttctatgtgtgagtattttagtgt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
676018 |
gcatggagagtgattgagtatgagttgatagactataggtcatagtcaaggtgttgttttggatttgtgtgctgatttctatgtgtgagtattttagtgt |
676117 |
T |
 |
| Q |
242 |
aacattttgttttcttggatagcgatacttgatgaatttgtatagatttgtgtgttcgatttttgtttacgtcattttagctaagttagttagttcaata |
341 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
676118 |
aacattttgttttcttggataacgatacttgatgaatttgtatagatt-----------tttgtgtttacatcattttagctaagttagttagttcaata |
676206 |
T |
 |
| Q |
342 |
attctattgtagtt |
355 |
Q |
| |
|
||||||||||||| |
|
|
| T |
676207 |
gttctattgtagtt |
676220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 338 - 374
Target Start/End: Original strand, 676235 - 676271
Alignment:
| Q |
338 |
aataattctattgtagttgtagtctctatctctgctc |
374 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| |
|
|
| T |
676235 |
aataattctattgtagttgtagtctctagctttgctc |
676271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University