View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_73 (Length: 377)
Name: NF1145_low_73
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_73 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 63 - 289
Target Start/End: Complemental strand, 8401162 - 8400935
Alignment:
| Q |
63 |
acatagttatgtgacaaatgaaaaccaagtcttttacccctttctcnnnnnnncacctttcggtgtacaattggtgcnnnnnnnnnnnnnn-cttatatg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
8401162 |
acatagttatgtgacaaatgaaaaccaagtcttttacccctttctctttttttcacctttcggtgtacaattggtgcaaacaaaaaaaaaaacttatatg |
8401063 |
T |
|
| Q |
162 |
tacagattgcattggacgagtaaatcatgacattcctcattcgtctgatattaaaatctacagattcttcccttaatatttttaaaatttacactagtat |
261 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8401062 |
tacatattgcattggacgagtaaataatgacattcctcattcgtctgatgttaaaatctacagattcttcccttaatatttttaaaatttacactagtat |
8400963 |
T |
|
| Q |
262 |
agcaacaaaaatcgaacgcccgaaggac |
289 |
Q |
| |
|
||||||||||||| |||| ||||||||| |
|
|
| T |
8400962 |
agcaacaaaaatctaacgaccgaaggac |
8400935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University