View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_low_91 (Length: 349)

Name: NF1145_low_91
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_low_91
NF1145_low_91
[»] chr8 (2 HSPs)
chr8 (166-252)||(45087479-45087565)
chr8 (88-169)||(45087615-45087696)


Alignment Details
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 166 - 252
Target Start/End: Complemental strand, 45087565 - 45087479
Alignment:
166 tattttaagattgattaattagcttgaaacttaaataaaatgtttgaacttattaaacaaaaattgaactcaaattacaaaaacact 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45087565 tattttaagattgattaattagcttgaaacttaaataaaatgtttgaacttattaaacaaaaattgaactcaaattacaaaaacact 45087479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 88 - 169
Target Start/End: Complemental strand, 45087696 - 45087615
Alignment:
88 atattgcccccaacaacactggaagcttatgccacaacacaattttgtccacaaaatgtatcacctacataaattcaatatt 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45087696 atattgcccccaacaacactggaagcttatgccacaacacaattttgtccacaaaatgtatcacctacataaattcaatatt 45087615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University