View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_91 (Length: 349)
Name: NF1145_low_91
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_91 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 166 - 252
Target Start/End: Complemental strand, 45087565 - 45087479
Alignment:
| Q |
166 |
tattttaagattgattaattagcttgaaacttaaataaaatgtttgaacttattaaacaaaaattgaactcaaattacaaaaacact |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45087565 |
tattttaagattgattaattagcttgaaacttaaataaaatgtttgaacttattaaacaaaaattgaactcaaattacaaaaacact |
45087479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 88 - 169
Target Start/End: Complemental strand, 45087696 - 45087615
Alignment:
| Q |
88 |
atattgcccccaacaacactggaagcttatgccacaacacaattttgtccacaaaatgtatcacctacataaattcaatatt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45087696 |
atattgcccccaacaacactggaagcttatgccacaacacaattttgtccacaaaatgtatcacctacataaattcaatatt |
45087615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University