View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_96 (Length: 337)
Name: NF1145_low_96
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_96 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 164 - 327
Target Start/End: Complemental strand, 15474909 - 15474746
Alignment:
| Q |
164 |
tcacttgcattgtgtatgattcttttctaccttgggcacttgatgtggctaaacaacatcggatttatggtgctgcttttttcaccaattcagctgctgt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15474909 |
tcacttgcattgtgtatgattcttttctaccttgggcacttgatgtggctaaacaacatcggatttatggtgctgcttttttcaccaattcagctgctgt |
15474810 |
T |
 |
| Q |
264 |
ttgtaacattttctgtcgtatacatcatggtttgattgaaactcctgtagatgaattgcctttg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15474809 |
ttgtaacattttctgtcgtatacatcatggtttgattgaaactcctgtagatgaattgcctttg |
15474746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 164 - 327
Target Start/End: Complemental strand, 15467358 - 15467195
Alignment:
| Q |
164 |
tcacttgcattgtgtatgattcttttctaccttgggcacttgatgtggctaaacaacatcggatttatggtgctgcttttttcaccaattcagctgctgt |
263 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15467358 |
tcacatgcattgtctatgattcttttctaccttgggcacttgatgttgctaaacaacatggtatttatggtgctgcttttttcactaattcagctgctgt |
15467259 |
T |
 |
| Q |
264 |
ttgtaacattttctgtcgtatacatcatggtttgattgaaactcctgtagatgaattgcctttg |
327 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
15467258 |
ttgtaacattttttgtcgtatacatcatggtttgattgaaattcctgttgatgaattgcctttg |
15467195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 15475072 - 15474988
Alignment:
| Q |
1 |
atcactgcaccaaacatctccgtcgaaccaatctctgatgggttcgacgaatccggtttttcacaagccaaaaatgttgaactct |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15475072 |
atcactgcaccaaacatctccgtcgaaccaatctctgatgggttcgacgaatccggtttttcacaagccaaaaatgttgaactct |
15474988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 7 - 85
Target Start/End: Complemental strand, 15467515 - 15467437
Alignment:
| Q |
7 |
gcaccaaacatctccgtcgaaccaatctctgatgggttcgacgaatccggtttttcacaagccaaaaatgttgaactct |
85 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
15467515 |
gcaccaaacgtatccgtcgaaccaatctctgatgggttcgacgaatccggttttacacaagccaacaatgttgaactct |
15467437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University