View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1145_low_99 (Length: 328)
Name: NF1145_low_99
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1145_low_99 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 30 - 321
Target Start/End: Complemental strand, 32039788 - 32039499
Alignment:
| Q |
30 |
gtatgatggacagtggaagctggcattgggattacaagatagaaggttctcacattaagctagaattcgtagaatcatagaccactaactatatcagatg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32039788 |
gtatgatggacagtggaagctggcattgggattacaagatagaaggttctcacattaagctagaattcgtagaatcatagaccactaactatatcagatg |
32039689 |
T |
 |
| Q |
130 |
tctgctgcgtgaatcatggttcacagttgatgtcgtagctcacctataataatttctactaccaagatgacaggttgaacagaagttcaacctttgtgat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32039688 |
tctgctgcgtgaatcatggttcacagttgatgtcgtagctcgcctataataatttctactaccaagatgacaggttgaacagaagttcaacctttgtgat |
32039589 |
T |
 |
| Q |
230 |
gttaggttgttttagacttctgttgta--atgtttgtaaaatctcttccatctgttctcttcgagtttttcttttcctgtaattatattattgg |
321 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
32039588 |
gttaggttgttttagacttctgttgtaatatgtttgtaaaatctcttccatctgttctcttcgtgtt----ttttcctgtaattatattattgg |
32039499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University