View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11460_low_18 (Length: 229)
Name: NF11460_low_18
Description: NF11460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11460_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 41705519 - 41705742
Alignment:
| Q |
1 |
tgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705519 |
tgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacc |
41705618 |
T |
 |
| Q |
101 |
cccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705619 |
cccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaa |
41705718 |
T |
 |
| Q |
201 |
ccaaagactgcggttcatctcact |
224 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
41705719 |
ccaaagactgcggttcatttcact |
41705742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University