View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11460_low_19 (Length: 220)
Name: NF11460_low_19
Description: NF11460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11460_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 61 - 171
Target Start/End: Complemental strand, 12804319 - 12804209
Alignment:
| Q |
61 |
gttaccaaaatgacaatcatcatgggaaagatattgttaacactattattgttatcatcaattttctcaatagccacttcatcaaaaagaagatcaagat |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12804319 |
gttaccaaaatgacaatcatcatgggaaagatattgttaacactattattgttatcatcaattttctcaatagccacttcatcaaaaagaagatcaagat |
12804220 |
T |
 |
| Q |
161 |
cttccaacaac |
171 |
Q |
| |
|
||||||||||| |
|
|
| T |
12804219 |
cttccaacaac |
12804209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University