View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11461_low_12 (Length: 393)
Name: NF11461_low_12
Description: NF11461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11461_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 1 - 375
Target Start/End: Original strand, 55162194 - 55162568
Alignment:
| Q |
1 |
tctaattatagttttgtctctctgatttgacagaaaagaaagcgtgccgtcaccgttcatgtatcagaccctaatggaaagaaattacaaggagcttctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55162194 |
tctaattatagttttgtctctctgatttgacagaaaagaaagcgtgccgtcaccgttcatgtatcagaccctaatggaaggaaattacaaggagcttctg |
55162293 |
T |
 |
| Q |
101 |
tgtttgtagagcaaatatcaaaagactttcctattggctctgcgatatcaaagaccattcttggcaacataccatatcagaattggtttttgaaacggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162294 |
tgtttgtagagcaaatatcaaaagactttcctattggctctgcgatagcaaagaccattcttggcaacataccatatcagaattggtttttgaaacggtt |
55162393 |
T |
 |
| Q |
201 |
caatgctgcagtgtttgaaaacgagcttaaatggtatgccacagagcctcatgaaggcagagtcaactacacaatttcagatcaaatgatgcaatttgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55162394 |
caatgctgcagtgtttgaaaacgagcttaaatggtatgccacagagcctcatgaaggcagcgtcaactacacaatttcagaccaaatgatgcaatttgtt |
55162493 |
T |
 |
| Q |
301 |
agagccaacaaaatcatagctagagggcacaatatattctgggaagaccctaaatacaatcctgcatgggttctt |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162494 |
agagccaacaaaatcatagctagagggcacaatatattctgggaagaccctaaatacaatcctgcatgggttctt |
55162568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University