View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_high_14 (Length: 268)
Name: NF11462_high_14
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 43491099 - 43490877
Alignment:
| Q |
18 |
agctttgactcatatcgtttctggagatgttccaacccaaagtgacgctgatatagttcatcataatagtgcaagtgaaggaagggttgcttttgcaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43491099 |
agctttgactcatatcgtttctggagatgttccaacccaaagtgacgctgatatagttcatcataatagtgcaattgaaggaagggttgcttttgcaaca |
43491000 |
T |
|
| Q |
118 |
aatatcaataataatatgtcttctccttctacaatacaatctttgtcttctccttcttcttcatctaattatgctactagttcttctctcaagagaacta |
217 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43490999 |
aatatcaataacaatatgtcttctccttctacaacacaatctttgtcttctccttcttcttcat---------------gttcttctctcaagagaacta |
43490915 |
T |
|
| Q |
218 |
gggaagatgatagatttgttggtgatttcaaattcctc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43490914 |
gggaagatgatagatttgttggtgatttcaaattcctc |
43490877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University