View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_high_6 (Length: 402)
Name: NF11462_high_6
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_high_6 |
 |  |
|
| [»] chr5 (74 HSPs) |
 |  |
|
| [»] chr6 (47 HSPs) |
 |  |
|
| [»] chr1 (75 HSPs) |
 |  |
|
| [»] chr7 (60 HSPs) |
 |  |
|
| [»] chr4 (81 HSPs) |
 |  |
|
| [»] chr2 (61 HSPs) |
 |  |
|
| [»] chr8 (80 HSPs) |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 84)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 318
Target Start/End: Original strand, 50419950 - 50420247
Alignment:
| Q |
17 |
agatagttagttaaagagagagtgaggagtagtggtaaaatgaatgaaagtgagaagnnnnnnnnt--ataatagtaaacaataaaagtgatttgtgaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
50419950 |
agatagttagttaaagagagagtgaggagtagtggtaaaatgaatgaaagtgagaagaaaaaaaaataataataataaataataaaagtgatttgtgaaa |
50420049 |
T |
 |
| Q |
115 |
cacagctggcgtaagaagagaatcggcatcatcgcaacgcaaggtgtggttggttgttccctaaaatcagagcaagatggagactcccgtgtgcttcact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50420050 |
cacagctggcgtaagaagagaatcggcatcatcgcaacgcaaggtgtggttggtggttccctaaaatcagagcaagatggagactcccgtgtgcttcact |
50420149 |
T |
 |
| Q |
215 |
gcactgccgctagcctactctatttattattattaatcacaacgtttaatgagtgtcattcgcattaattaaagtattaaaatactttgagtgtcacttt |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50420150 |
gcactgccgctagcctactctat------ttattaatcacaacgtttaatgagtgtcattcgcattaattaaagtattaaaatactttgagtgtcacttt |
50420243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 27330003 - 27329930
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
27330003 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
27329930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 44625296 - 44625223
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44625296 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
44625223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 51879094 - 51879167
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
51879094 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
51879167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 34102065 - 34102138
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
34102065 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctggggttcgaaccccggacacc |
34102138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 15085755 - 15085682
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
15085755 |
cccgtgagctttgctcggttggtagggacaaatgcattttatatgcaggggtcggggttcgaaccccggacacc |
15085682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 41710582 - 41710655
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||| | ||||||||||||| |||||||||| |
|
|
| T |
41710582 |
cccgtgagctttgctcagttggtagggacaaatgcattttacatgcaggggccggggttcgaatcccggacacc |
41710655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 49029015 - 49028942
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
49029015 |
tcccgtgagctttgctcagttggtagggacaaatgcattttatatgcagggaccggggttcgaaccccgaacac |
49028942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 328 - 400
Target Start/End: Original strand, 46767341 - 46767413
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| | || | ||||| ||||||||||| |
|
|
| T |
46767341 |
tcccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctgaggttcaaaccccggaca |
46767413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 337 - 402
Target Start/End: Complemental strand, 41253812 - 41253747
Alignment:
| Q |
337 |
ctttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
41253812 |
ctttgctcagttggtatagacaaatgcattttatatgcaggggccggggttcgaaccccgaacacc |
41253747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 4138999 - 4139071
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4138999 |
tcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
4139071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 9176657 - 9176585
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9176657 |
tcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaagagccggggttcgaaccccggacac |
9176585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 25884059 - 25883986
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||| ||||||||||||||||||||| |||||||| | | |||||||||||||||||||||| |
|
|
| T |
25884059 |
cccgtgagcttagcttagttggtagggacaaatgcataatatatgcaggggtcggggttcgaaccccggacacc |
25883986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 7920320 - 7920391
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7920320 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaagagccggggttcgaaccccggacac |
7920391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 28689742 - 28689671
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28689742 |
cccgtgaacttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
28689671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 31327788 - 31327717
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31327788 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
31327717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 37800681 - 37800610
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37800681 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
37800610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 40548303 - 40548374
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40548303 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
40548374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 40933901 - 40933830
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40933901 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
40933830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 50496884 - 50496813
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50496884 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
50496813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 332 - 402
Target Start/End: Original strand, 35200557 - 35200627
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||| | | |||||||| ||||||||||||| |
|
|
| T |
35200557 |
gtgagcttagctcagttggtagggacaaatgcattttatatgtagaggtcggggttcaaaccccggacacc |
35200627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 398
Target Start/End: Complemental strand, 31327571 - 31327503
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
31327571 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccgga |
31327503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 32256624 - 32256552
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
32256624 |
cccgtgagcttagctcagttggtagggatat-tgcatgttatatgcaggggccggggttcgaaccccggacacc |
32256552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 398
Target Start/End: Original strand, 45701344 - 45701412
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
45701344 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccgga |
45701412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 6920033 - 6919962
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||||||| |||| |
|
|
| T |
6920033 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccgaacac |
6919962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 10176961 - 10176902
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10176961 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
10176902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 10482923 - 10482852
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||| ||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
10482923 |
cccgtgaacttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaactccggacac |
10482852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 18194350 - 18194409
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18194350 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
18194409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 33225418 - 33225347
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
33225418 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggagccggggttcgaaccccagacac |
33225347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 37488530 - 37488459
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
37488530 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggggccggggttcgaaccccggacac |
37488459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 49447150 - 49447209
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49447150 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
49447209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 50234124 - 50234195
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50234124 |
cccgtgagcttacctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
50234195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 52974123 - 52974052
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52974123 |
cccgtgagcttaactcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
52974052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 9624991 - 9625052
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
9624991 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
9625052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 10828481 - 10828542
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgag-ccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||| |||| ||||||||||| |||||| |
|
|
| T |
10828481 |
gctcagttggtagggacaaatgcatattatatgca-gagaccggagttcgaaccccagacacc |
10828542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 27183768 - 27183707
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
27183768 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
27183707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 402
Target Start/End: Original strand, 39719934 - 39720007
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| || |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
39719934 |
tcccgtgagtttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
39720007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 401
Target Start/End: Complemental strand, 5636866 - 5636798
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccctggacac |
5636798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 401
Target Start/End: Original strand, 15975155 - 15975223
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
15975155 |
gtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaacctcggacac |
15975223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 361 - 402
Target Start/End: Complemental strand, 22472353 - 22472312
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22472353 |
tgcatattatatgcaagagccggggttcgaaccccggacacc |
22472312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 361 - 402
Target Start/End: Original strand, 32144615 - 32144656
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32144615 |
tgcatattatatgcaggagccggggttcgaaccccggacacc |
32144656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 34102681 - 34102609
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| | |||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
34102681 |
cccgtgagcttagttcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
34102609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 41936465 - 41936405
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
41936465 |
gctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
41936405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 398
Target Start/End: Complemental strand, 44652052 - 44651984
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||| ||||||||||||||| |
|
|
| T |
44652052 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccgga |
44651984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 394
Target Start/End: Complemental strand, 46795999 - 46795935
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccc |
394 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||||||| | |||||||||||||||| |
|
|
| T |
46795999 |
cccgtgagcttagctcagttggtagggatat-tgcattttatatgcaggggccggggttcgaaccc |
46795935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 47098731 - 47098803
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
47098731 |
tcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccagacac |
47098803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 48739814 - 48739742
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||||||| | || |||||||||||||| |||||| |
|
|
| T |
48739814 |
cccgtgagcttagctcagttggtagggatat-tgcattttatatgcaggggctggggttcgaaccccagacacc |
48739742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 53163594 - 53163666
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||| | | |||||||||||||||||||||||| |
|
|
| T |
53163594 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgtaggggccggggttcgaaccccggacacc |
53163666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 401
Target Start/End: Original strand, 53577958 - 53578026
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgt-tgcatattatatgcaagagccggggttcgaaccccggacac |
53578026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 2522926 - 2522997
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
2522926 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaagagctggggtttgaaccccggacac |
2522997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 7269955 - 7270026
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
7269955 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaactccggacac |
7270026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 22251512 - 22251452
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| | |||||||||||||||||| |||| |
|
|
| T |
22251512 |
ctcagttggtatggacaaatgcataatatatgcacggtccggggttcgaaccccggccacc |
22251452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 31529028 - 31528957
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | || || ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
31529028 |
cccgtgagcttagctcagttggtagggatat-tgaatattatatgcaggagtcggggttcgaaccccggacac |
31528957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 33706797 - 33706726
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||| |||||||||| | | ||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33706797 |
cccgtgagcttagctcaattggtagggatat-tacatattatatgcaagagccggggttcgaaccccggacac |
33706726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 402
Target Start/End: Complemental strand, 46336572 - 46336500
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||| ||| |||||||||||||||| |||| ||| |||||||| | | |||||||||||||||| ||||| |
|
|
| T |
46336572 |
ccgtgagcttagctcagttggtagggataaatacataatatatgcaggggtcggggttcgaaccccgaacacc |
46336500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 52410311 - 52410240
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
52410311 |
cccgtgagcttagctcagttggtaggga-tattgcatattatatgcaggagccgggattcgaaccccagacac |
52410240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 53432794 - 53432735
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
53432794 |
ctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
53432735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 14868693 - 14868754
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
14868693 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccgaacacc |
14868754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 20407274 - 20407347
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgag-ccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||| | ||||||||||||| ||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
20407274 |
cccgtgagcttagctcagttgatggggacaaatgcatattatatgca-gagatcggggttcgaaccccagacacc |
20407347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 401
Target Start/End: Original strand, 27668955 - 27668993
Alignment:
| Q |
363 |
cattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27668955 |
cattttatatgcaagagtcggggttcgaaccccggacac |
27668993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 402
Target Start/End: Original strand, 32776214 - 32776283
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||| | |||||| | |||||||||||||||||||||||| |
|
|
| T |
32776214 |
gtgagcttagctcagttggtagggacat-tgcataatttatgcaggggccggggttcgaaccccggacacc |
32776283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 36472489 - 36472439
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaac |
392 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| ||| |||| ||||||| |
|
|
| T |
36472489 |
ctcagttggtagggacaaatgcatattgtatgcaggagtcgggattcgaac |
36472439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 401
Target Start/End: Original strand, 50659623 - 50659661
Alignment:
| Q |
363 |
cattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
50659623 |
cattttatatgcaggggccggggttcgaaccccggacac |
50659661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 394
Target Start/End: Original strand, 882389 - 882453
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccc |
394 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
882389 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccc |
882453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 3894543 - 3894615
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| | |||||||||| ||| | ||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
3894543 |
tcccgtgagcttagttcagttggtatggatat-tgcatattatatgcaggagccggggttcgaactccggacac |
3894615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 5326107 - 5326035
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| ||||||||||||| || | ||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
5326107 |
tcccgtgagcttagctcagttggtagcgatat-tgcatattacatgcatgagcaagggttcgaaccccggacac |
5326035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 364 - 401
Target Start/End: Complemental strand, 9220288 - 9220251
Alignment:
| Q |
364 |
attttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9220288 |
attttatatgcaggagtcggggttcgaaccccggacac |
9220251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 398
Target Start/End: Original strand, 11820004 - 11820072
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||| | ||| |||||||||||||||||| |
|
|
| T |
11820004 |
cccgtgagcttagctcagttggtagggatat-tgcatgttatatgtaggagtcggggttcgaaccccgga |
11820072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 24303390 - 24303462
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||| ||||||| ||||| | |||||| | |||||||||||||||||||||||| |
|
|
| T |
24303390 |
cccgtgagcttagctcagttggcagggacat-tgcataatttatgcaggggccggggttcgaaccccggacacc |
24303462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 402
Target Start/End: Complemental strand, 24751361 - 24751286
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||| ||||| |||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
24751361 |
tgtcccgtgagcatagctcagttagtagg-acaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
24751286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 402
Target Start/End: Original strand, 33206751 - 33206826
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||||||||| |||| |||||| ||||||||| | || ||||||||||||||||||||| |
|
|
| T |
33206751 |
tgtcccgtgagcatagctcagttggtagg-acaa-tgcattattatatgcaggggctggggttcgaaccccggacacc |
33206826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 33607010 - 33606939
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||| ||||| |||||||||| | ||||||||||||||| | | | ||||||||||||||||||| |
|
|
| T |
33607010 |
tcccgtgaacttagctcaattggtaggga-tattgcattttatatgcaggggtc-gggttcgaaccccggacac |
33606939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 402
Target Start/End: Complemental strand, 42271114 - 42271039
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||||||||| |||| |||||| ||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
42271114 |
tgtcccgtgagcatagctcagttggtagg-acaa-tgcattgttatatgcaggggccggggttcgaactccggacacc |
42271039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 45118652 - 45118704
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccc |
394 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| | |||||||||||||||| |
|
|
| T |
45118652 |
gctcagttggtagggacat-tgcattatatatgcaggggccggggttcgaaccc |
45118704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 402
Target Start/End: Original strand, 52030130 - 52030190
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| |||||||| || ||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
52030130 |
ctcagttggcagggacaa-tgtattattatatgcaggggccggggttcgaaccccggacacc |
52030190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 17218500 - 17218559
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | |||||||||| |||||||||||| |
|
|
| T |
17218500 |
gctcagttggtagggatat-tgcatattatatgcaagggccggggttcaaaccccggacac |
17218559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 19591618 - 19591578
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
19591618 |
tgcatattatatgtaggagccggggttcgaaccccggacac |
19591578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 19996510 - 19996451
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||||||| |
|
|
| T |
19996510 |
gctcagttggtagggatat-tgcatattatatgcaggagttggggttcgaaccccggacac |
19996451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 19999867 - 19999938
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | || |||||||||||||| ||||| |
|
|
| T |
19999867 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggctggggttcgaaccccagacac |
19999938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 22502001 - 22501930
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | || |||||||||||||| ||||| |
|
|
| T |
22502001 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggctggggttcgaaccccagacac |
22501930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 30555297 - 30555226
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||| ||||| |||| |||| ||||||||||||||| |
|
|
| T |
30555297 |
cccgtgagcttagctcagttggtagggatat-tgcatattaaatgcaagagcaggggatcgaaccccggacac |
30555226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 45551879 - 45551808
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||| | | |||||| |||||||||||||||| |
|
|
| T |
45551879 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgtaggggccgggattcgaaccccggacac |
45551808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 49728729 - 49728769
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| ||||||||| |
|
|
| T |
49728729 |
tgcattttatatgcaagagccagggttcgaatcccggacac |
49728769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 53906410 - 53906450
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
53906410 |
tgcattttatatgcaggggccggggtttgaaccccggacac |
53906450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 3e-27; HSPs: 74)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 328 - 402
Target Start/End: Complemental strand, 17891931 - 17891857
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
17891931 |
tcccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
17891857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 23938004 - 23937931
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
23938004 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
23937931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 3740953 - 3741026
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
3740953 |
cccgtgagctttactcagttggtagggacaaatgtattttatatgcaggggtcggggttcgaaccccggacacc |
3741026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 337 - 398
Target Start/End: Complemental strand, 3821484 - 3821423
Alignment:
| Q |
337 |
ctttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
3821484 |
ctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaatcccgga |
3821423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 33909004 - 33909077
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
33909004 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgtagaggtcggggttcgaaccccggacacc |
33909077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 343 - 401
Target Start/End: Complemental strand, 28871381 - 28871323
Alignment:
| Q |
343 |
tcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | ||||||||||| ||||||||| |
|
|
| T |
28871381 |
tcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaatcccggacac |
28871323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 332 - 402
Target Start/End: Complemental strand, 32293545 - 32293475
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| || |||||||||||||||| ||||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
32293545 |
gtgaaattagctcagttggtagggataaatgcattttatatgccggagtcggggttcgaacctcggacacc |
32293475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 329 - 375
Target Start/End: Complemental strand, 36068820 - 36068774
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgca |
375 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36068820 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgca |
36068774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 4418413 - 4418340
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||| |||||||||||||||||| | || |||||||||||| |||||||| |
|
|
| T |
4418413 |
cccgtgagcttaactcagttggtagggataaatgcattttatatgcaggggctggggttcgaacctcggacacc |
4418340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 35515511 - 35515583
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35515511 |
tcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
35515583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 43580877 - 43580949
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
43580877 |
tcccgtgaacttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaatcccggacac |
43580949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 4417755 - 4417684
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4417755 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
4417684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 9835033 - 9835104
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9835033 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
9835104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 12463756 - 12463827
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12463756 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
12463827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 32505688 - 32505759
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32505688 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
32505759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 401
Target Start/End: Original strand, 8968750 - 8968820
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8968750 |
ccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
8968820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 30209060 - 30208999
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| | | ||||||||||||| ||| |||| |
|
|
| T |
30209060 |
gctcacttggtagggacaaatgcattttatatgcaggggtcggggttcgaacctcgggcacc |
30208999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 4745946 - 4745875
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
4745946 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgaaggagccggggttcgaaccccggacac |
4745875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 5966841 - 5966900
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5966841 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
5966900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 6518846 - 6518775
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
6518846 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
6518775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 11774529 - 11774458
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||| ||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11774529 |
cccgtgaccttagctcagtttgtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
11774458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 11897248 - 11897319
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
11897248 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
11897319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 17545242 - 17545171
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17545242 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacac |
17545171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 24033089 - 24033148
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
24033089 |
gctcagttggtagggatat-tgcattttatatgcaggggccggggttcgaaccccggacac |
24033148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 25400425 - 25400366
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25400425 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
25400366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 39919163 - 39919092
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||| |||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39919163 |
cccgtgagcttagcttagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
39919092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 41179873 - 41179802
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
41179873 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaatcccggacac |
41179802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 42525412 - 42525471
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42525412 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
42525471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 1463879 - 1463940
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
1463879 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
1463940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 4067982 - 4068054
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||||| ||||||| || |||||| | | || ||||||||||||||||||| |
|
|
| T |
4067982 |
cccgtgagcttagctcagttggtagggac-aatgcatattttatgcagggggcgaggttcgaaccccggacacc |
4068054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 12891557 - 12891629
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||| | | |||||||||||||||||||||||| |
|
|
| T |
12891557 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgtaggggccggggttcgaaccccggacacc |
12891629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 13622016 - 13621944
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
13622016 |
cccgtgagcttagctcagttggtagggatatc-gcatattatatgcaggggccggggttcgaaccccggacacc |
13621944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 26376963 - 26377035
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||||||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
26376963 |
cccgtgaacttagctcagttggtaaggac-aatgcatattatatgcaacgtccggggttcgaactccggacacc |
26377035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 42916389 - 42916461
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | || || ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
42916389 |
cccgtgagcttagctcagttggtagggatat-tgtatgttatatgcaggggccggggttcgaaccccggacacc |
42916461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 1743127 - 1743197
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
1743127 |
cccgtgagcttagctcagttggtaggga-tattgcatattatatgcaggagcc-gggttcgaaccccggacac |
1743197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 2328592 - 2328663
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||| |||||||||||| | ||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
2328592 |
cccgtgagcttagcttagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccagacac |
2328663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 2848213 - 2848284
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | || || ||||||||||||| |||||||||||||||| |||| |
|
|
| T |
2848213 |
cccgtgagcttagctcagttggtagggatat-tgtatattatatgcatgaggcggggttcgaaccccgcacac |
2848284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 332 - 396
Target Start/End: Complemental strand, 6734806 - 6734742
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccg |
396 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||| | | |||||| |||||| |||| |
|
|
| T |
6734806 |
gtgaacttagctcagttggtagggacaaatgcataatatatgtaggggccgggtttcgaatcccg |
6734742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 14641148 - 14641108
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14641148 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
14641108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 18638610 - 18638669
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18638610 |
gctcagttggtagggatatc-gcattttatatgcaggggccggggttcgaaccccggacac |
18638669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 21918052 - 21918123
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| ||||||||||||| |||||| |
|
|
| T |
21918052 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccctggacac |
21918123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 26902621 - 26902692
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||| ||||||||||| | |||||| | | ||||||||||||||||||||| |
|
|
| T |
26902621 |
cccgtgagcttagctcagttggtagcgacaaatgcataat-tatgcaggggtcggggttcgaaccccggacac |
26902692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 27765257 - 27765328
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
27765257 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggaggcggggttcgaaccccgcacac |
27765328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 27798633 - 27798692
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27798633 |
gctcagttggtagggatat-tgcatattatatgcaagagccagggttcgaaccccggacac |
27798692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 36888465 - 36888394
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| | |||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
36888465 |
cccgtgagcttagttcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
36888394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 362 - 401
Target Start/End: Original strand, 18756018 - 18756057
Alignment:
| Q |
362 |
gcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
18756018 |
gcattttatatgcaggagtcggggttcgaaccccggacac |
18756057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 367 - 402
Target Start/End: Original strand, 28537169 - 28537204
Alignment:
| Q |
367 |
ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28537169 |
ttatatgcatgggccggggttcgaaccccggacacc |
28537204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 362 - 401
Target Start/End: Original strand, 34398489 - 34398528
Alignment:
| Q |
362 |
gcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34398489 |
gcattttatatgcaggagtcggggttcgaaccccggacac |
34398528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 362 - 401
Target Start/End: Original strand, 37034838 - 37034877
Alignment:
| Q |
362 |
gcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
37034838 |
gcattttatatgcaggagccggagttcgaaccccggacac |
37034877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 401
Target Start/End: Complemental strand, 2301604 - 2301570
Alignment:
| Q |
367 |
ttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2301604 |
ttatatgcaggagccggggttcgaaccccggacac |
2301570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 399
Target Start/End: Original strand, 12767964 - 12768033
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggac |
399 |
Q |
| |
|
||||||| ||| | |||||||||||||| | ||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
12767964 |
cccgtgagcttagttcagttggtagggatat-tgcatattatatgcaggagccggcgttcgaaccccggac |
12768033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 20735274 - 20735201
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| | |||||||||| |||||||| |||||| ||||||| | | ||||||||||||| |||||||||| |
|
|
| T |
20735274 |
cccgtgaacatagctcagttggcagggacaa-tgcattattatatgtaggggccggggttcgaatcccggacacc |
20735201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 395
Target Start/End: Complemental strand, 25648155 - 25648090
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaacccc |
395 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
25648155 |
cccgtgagcttagctcagttggtagggatat-tgcatattacatgcaggagccggggttcgaacccc |
25648090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 402
Target Start/End: Original strand, 41930104 - 41930177
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||| |||||||| |||||| | ||||||||||||||| | || |||||||||||||| |||||| |
|
|
| T |
41930104 |
tcccgtgaacttaactcagttgatagggatat-tgcattttatatgcaggggctggggttcgaaccccagacacc |
41930177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 343 - 402
Target Start/End: Complemental strand, 3536020 - 3535962
Alignment:
| Q |
343 |
tcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||| |||||| |||||| || |||||||||||||||||||||||||| |
|
|
| T |
3536020 |
tcagttggcagggaca--tgcattgttatatacaggagccggggttcgaaccccggacacc |
3535962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 6447566 - 6447506
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
6447566 |
ctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaacctcggacacc |
6447506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 8241062 - 8241122
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
8241062 |
gctcagttggtagggatat-tgcatattatatgcaagggtcggggttcgaaccccggacacc |
8241122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 9125663 - 9125734
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||| || | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
9125663 |
cccgtgagcttagctcagttggtagcgatat-tgcatattatatgcagg-gccggggttcgaaccccggacacc |
9125734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 359
Target Start/End: Complemental strand, 14897677 - 14897644
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaa |
359 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
14897677 |
tgtcccgtgaactttgctcagttggtatggacaa |
14897644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 398
Target Start/End: Complemental strand, 16386799 - 16386743
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
16386799 |
gctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccgga |
16386743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 402
Target Start/End: Complemental strand, 32158515 - 32158440
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| ||| ||||| |||||||| |||| |||||| ||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
32158515 |
tgtcccgtgagcttagctcaattggtagg-acaa-tgcattattatatgcaggggccggggttcgaaccccgaacacc |
32158440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 331 - 396
Target Start/End: Original strand, 34436850 - 34436914
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccg |
396 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||||| |||||||| | |||||||||| ||||||| |
|
|
| T |
34436850 |
cgtgagcttagctcagttggtagggac-aatgcataatatatgcaagggccggggttcaaaccccg |
34436914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 10404158 - 10404198
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10404158 |
tgcatattatatgcaggagtcggggttcgaaccccggacac |
10404198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Original strand, 10943741 - 10943785
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
10943741 |
aatgcattattatatgcaggggccggggttcgaaccccggacacc |
10943785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 16603398 - 16603469
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
16603398 |
cccgtgagcttagctcagttggtaggga-tattgcatattatatgcagaagccgggattcgaaccccagacac |
16603469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 25729510 - 25729439
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| | | ||||||||||||||| ||||| |
|
|
| T |
25729510 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggggtcggggttcgaaccccagacac |
25729439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 32706322 - 32706393
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | | ||| ||||||| | |||||||| |||||||||||||||| |
|
|
| T |
32706322 |
cccgtgagcttagctcagttggtagggatat-tacatattatatggaggagccgggattcgaaccccggacac |
32706393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 33802481 - 33802521
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
33802481 |
tgcattttatatgtacgagccgggattcgaaccccggacac |
33802521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 393
Target Start/End: Original strand, 36422494 - 36422558
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaacc |
393 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||||| |||||||| | ||| |||||||||| |
|
|
| T |
36422494 |
cccgtgagcttagctcagttggtaggaacaaatgcataatatatgcaggggccaaggttcgaacc |
36422558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 39886270 - 39886211
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||| | |||| |||||||||||||||||||| |
|
|
| T |
39886270 |
gctcagttggtagggatat-tgcatattatatgtaggagctggggttcgaaccccggacac |
39886211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 40091477 - 40091548
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| |||||| ||||||||| |||||||| |
|
|
| T |
40091477 |
cccgtgagcttaactcagttggtaggga-tattgcatattatatgcaagagccgaggttcgaactccggacac |
40091548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 41156359 - 41156399
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
41156359 |
tgcatattatatgcaggagccggggttcgaactccggacac |
41156399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 41477428 - 41477357
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| | || ||||||||||||||| |||| |
|
|
| T |
41477428 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggggctggggttcgaaccccgaacac |
41477357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 42320317 - 42320388
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||| |||||||||||| |||| |
|
|
| T |
42320317 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggagttcgaaccccgaacac |
42320388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 1e-26; HSPs: 47)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 27667159 - 27667232
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
27667159 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
27667232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 18904264 - 18904337
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
18904264 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaaccccggacacc |
18904337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 332 - 402
Target Start/End: Original strand, 32616386 - 32616456
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| | || |||||||||| |||||||||| |
|
|
| T |
32616386 |
gtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctggggttcgaatcccggacacc |
32616456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 32621641 - 32621580
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||| ||| |||||| |
|
|
| T |
32621641 |
gctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaatcccagacacc |
32621580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 32142095 - 32142034
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | || |||||||||||||| |||||| |
|
|
| T |
32142095 |
gctcagttggtagggacaaatgcattttatatgtaggggctggggttcgaaccccagacacc |
32142034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 7207844 - 7207915
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7207844 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
7207915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 10934599 - 10934670
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10934599 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
10934670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 17441909 - 17441838
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17441909 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
17441838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 19953898 - 19953827
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19953898 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
19953827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 32611625 - 32611553
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||| ||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32611625 |
tcccatgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
32611553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 330 - 402
Target Start/End: Complemental strand, 7897188 - 7897116
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||| ||| | |||||||||||||| |||||||| |||||||| | | |||||||||||||||||||||| |
|
|
| T |
7897188 |
ccgtgagcttagatcagttggtagggataaatgcataatatatgcaggggtcggggttcgaaccccggacacc |
7897116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 10483606 - 10483535
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
10483606 |
cccgtgatcttagctcagttggtagggatat-tgcattttatatgcaggggtcggggttcgaaccccggacac |
10483535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 333 - 401
Target Start/End: Complemental strand, 28148799 - 28148732
Alignment:
| Q |
333 |
tgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| |||||||||||||||| | ||||| ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
28148799 |
tgaacttagctcagttggtagggatat-tgcatattatatgcaggagccgggtttcgaaccccggacac |
28148732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 31802053 - 31802124
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31802053 |
cccgtgagcttaactcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
31802124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 33573817 - 33573888
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
33573817 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccctggacac |
33573888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 329 - 396
Target Start/End: Original strand, 9704417 - 9704483
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccg |
396 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||| ||||||||| |||||| ||||||||||||| |
|
|
| T |
9704417 |
cccgtgaacttagctcagttggtaggga-tattgcatattatatgcaggagccgaggttcgaaccccg |
9704483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 331 - 401
Target Start/End: Original strand, 743565 - 743634
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| |||||||||||||||| | ||||| ||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
743565 |
cgtgagcttagctcagttggtagggatat-tgcatattagatgcaggagccggggttcgaaccccggacac |
743634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 1968996 - 1969068
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | | ||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
1968996 |
cccgtgagcttagctcagttggtagggatat-tacatattatatgcaggggccggggttcgaaccccggacacc |
1969068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 2251838 - 2251910
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
2251838 |
cccgtgagcttagctcagttggtagggatat-tgcatactatatgcaggggccggggttcgaaccccggacacc |
2251910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 15091448 - 15091520
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
15091448 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaatcccggacacc |
15091520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 401
Target Start/End: Original strand, 31935102 - 31935170
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||| ||| |||||||||||||||| | ||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatat-tgcattttatatgcaggggtcggggttcgaaccccggacac |
31935170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 402
Target Start/End: Original strand, 3294765 - 3294836
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||| ||| |||||||||||||||| | ||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggtcggggttcgaaccccggacacc |
3294836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 3794243 - 3794172
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
3794243 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggaggcggggttcgaaccccgcacac |
3794172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 6210054 - 6210125
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||| ||||||||| | || |||||||||||||| ||||| |
|
|
| T |
6210054 |
cccgtgaacttagctcagttggtaggga-tattgcatattatatgcaggggctggggttcgaaccccagacac |
6210125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 9246452 - 9246381
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
9246452 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggaggcggggttcgaaccccgcacac |
9246381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 9435626 - 9435697
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | || |||||||||||||||||||| |
|
|
| T |
9435626 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggctggggttcgaaccccggacac |
9435697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 10517199 - 10517270
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||| ||| | ||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
10517199 |
cccgtgagcttagctcagttggtatggatat-tgcattttatatgcaggggtcggggttcgaaccccggacac |
10517270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 395
Target Start/End: Complemental strand, 1100310 - 1100244
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaacccc |
395 |
Q |
| |
|
|||||||||||| |||||||||||||||| | | |||||||||||||| || ||| ||||||||||| |
|
|
| T |
1100310 |
tcccgtgaacttagctcagttggtagggatata-gcattttatatgcagtagtcggtgttcgaacccc |
1100244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 367 - 402
Target Start/End: Complemental strand, 19680309 - 19680274
Alignment:
| Q |
367 |
ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19680309 |
ttatatgcaggagccggggttcgaaccccggacacc |
19680274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 393
Target Start/End: Original strand, 24129322 - 24129373
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaacc |
393 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||| ||||||||||||||| |
|
|
| T |
24129322 |
ctcagttggtagggacaaatacataatatatacatgggccggggttcgaacc |
24129373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 9064874 - 9064935
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
9064874 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccagacacc |
9064935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 14981789 - 14981728
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
14981789 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccctggacacc |
14981728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 331 - 364
Target Start/End: Complemental strand, 1368256 - 1368223
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgca |
364 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
1368256 |
cgtgaacttagctcagttggtagggacaaatgca |
1368223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 6658641 - 6658569
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||| |||| ||||||| || ||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
6658641 |
cccgtgagcttagcttagttagtaggga-aattgcataatatatgcaggggccggggttcgaaccccggacacc |
6658569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 7177295 - 7177367
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | || |||||||||||| | || |||||||||||||| |||||| |
|
|
| T |
7177295 |
cccgtgagcttagctcagttggtagggatat-tgtattttatatgcaggggctggggttcgaaccccagacacc |
7177367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 7545329 - 7545401
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||| |||||||||||||| ||||| |
|
|
| T |
7545329 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccagggttcgaaccccgaacacc |
7545401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 402
Target Start/End: Original strand, 8297658 - 8297699
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
8297658 |
tgcatgttatatgcaggggccggggttcgaaccccggacacc |
8297699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 402
Target Start/End: Original strand, 12089091 - 12089166
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||||||||| |||| |||||| ||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
12089091 |
tgtcccgtgagcatagctcagttggtagg-acaa-tgcattattatatgcaggggccggagttcgaaccccggacacc |
12089166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 398
Target Start/End: Complemental strand, 16268173 - 16268136
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
16268173 |
tgcattttatatgcaggggccggggttcgaaccccgga |
16268136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 27218883 - 27218955
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| ||||||||| |||||| | ||||| ||||||| | |||||||| |||||||||||||||| |
|
|
| T |
27218883 |
tcccgtgaccttagctcagttgatagggatat-tgcatattatatgtaggagccgggattcgaaccccggacac |
27218955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 30704960 - 30705032
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| | |||||||||||||| | ||||| ||||||| | | |||||||||||||||||||||||| |
|
|
| T |
30704960 |
cccgtgagcttagttcagttggtagggatat-tgcatgttatatgtaggggccggggttcgaaccccggacacc |
30705032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 402
Target Start/End: Original strand, 3709871 - 3709931
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| |||| ||||||||||| ||||||||| | | |||||||||||||| |||||| |
|
|
| T |
3709871 |
ctcagtttgtagagacaaatgcatattatatgcaaggggtggggttcgaaccccagacacc |
3709931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 392
Target Start/End: Complemental strand, 4869769 - 4869706
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaac |
392 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||| |
|
|
| T |
4869769 |
tcccgtgagcttagctcagttggtaggga-tactgcatattatatgcaggggccggggttcgaac |
4869706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 5052143 - 5052072
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||| |||||||||| | |||||||||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
5052143 |
cccgtgagcttagctcaattggtagggatatc-gcattttatatgcaggagtcggggtttgaaccccggacac |
5052072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 7865425 - 7865354
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||| |||||| |||||| |
|
|
| T |
7865425 |
cccgtgagcttagctcagttggtaggga-tattgcatattatatgcaggggccggggtttgaaccctggacac |
7865354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 9372271 - 9372200
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | | |||||||||||||| |||||| |
|
|
| T |
9372271 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggtcggggttcgaaccctggacac |
9372200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 17454784 - 17454744
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
17454784 |
tgcatattatatgcaggagtcggggttcgaaccccggacac |
17454744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 1e-26; HSPs: 75)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 18512646 - 18512573
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
18512646 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
18512573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 331 - 398
Target Start/End: Original strand, 13763762 - 13763829
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
13763762 |
cgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctggggttcgaaccccgga |
13763829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 18911850 - 18911923
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||| | | | |||||||||||||||||||| |
|
|
| T |
18911850 |
cccgtgagctttgctcagttggtagggacaaatgaattttatatgcaggggtcagggttcgaaccccggacacc |
18911923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 1570262 - 1570191
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1570262 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
1570191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 6438134 - 6438063
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6438134 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
6438063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 15819671 - 15819600
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15819671 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
15819600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 16343028 - 16343099
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16343028 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
16343099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 46965740 - 46965811
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46965740 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
46965811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 50899580 - 50899509
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50899580 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
50899509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 375
Target Start/End: Original strand, 9968483 - 9968532
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcattttatatgca |
375 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9968483 |
tgtcccgtgagcttagctcagttggtagggacaaatgcatattatatgca |
9968532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 21265656 - 21265728
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
21265656 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
21265728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 33207205 - 33207277
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
33207205 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
33207277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 330 - 398
Target Start/End: Original strand, 2277755 - 2277822
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
|||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccgga |
2277822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 6893307 - 6893236
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
6893307 |
cccgtgagcttagctcagttggtagggatat-tgcattttatatgcaggggccgaggttcgaaccccggacac |
6893236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 22563386 - 22563457
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
22563386 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacac |
22563457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 25999850 - 25999921
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
25999850 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
25999921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 32594251 - 32594322
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
32594251 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
32594322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 39347018 - 39346978
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39347018 |
tgcattttatatgcaggagccggggttcgaaccccggacac |
39346978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 330 - 401
Target Start/End: Original strand, 34058215 - 34058285
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||| ||| |||||||||||||||| | ||||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacac |
34058285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 361 - 399
Target Start/End: Complemental strand, 30434 - 30396
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggac |
399 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30434 |
tgcattttatatgcaggagccggggttcgaaccccggac |
30396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 17350069 - 17350130
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
17350069 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
17350130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 50199561 - 50199502
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
50199561 |
ctcagttggtagggaca--tgcattgttatatgcaggggccggggttcgaaccccggacacc |
50199502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 398
Target Start/End: Complemental strand, 4482668 - 4482600
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
4482668 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggagttcgaaccccgga |
4482600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 401
Target Start/End: Complemental strand, 13538513 - 13538445
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| | |||||||||||||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13538513 |
gtgaacttagttcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacac |
13538445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 36666646 - 36666574
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||||| ||||| | |||||| | |||||||||||||||||||||||| |
|
|
| T |
36666646 |
cccgtgagcttagctcagttggtagggacat-tgcataatttatgcaggggccggggttcgaaccccggacacc |
36666574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 40519614 - 40519542
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccgggg-ttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
40519614 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccgggggttcgaaccccggacac |
40519542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 42490480 - 42490408
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
42490480 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggtcggggttcgaaccccggacacc |
42490408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 44732633 - 44732705
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44732633 |
cccgtgagcttaactcagttggtagggatat-tgcatattatatgcaagggccggggttcgaaccccggacacc |
44732705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 48638532 - 48638604
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||||||| | || |||||||||||||| |||||| |
|
|
| T |
48638532 |
cccgtgagcttagctcagttggtagggatat-tgcattttatatgcaggggctggggttcgaaccccagacacc |
48638604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 1151759 - 1151830
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| |||||| || |||||||| |||||||||||||||| |
|
|
| T |
1151759 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatacaggagccgggattcgaaccccggacac |
1151830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 6463094 - 6463035
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | || |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
6463094 |
gctcagttggtagggatat-tgtattttatatgcaggggccggggttcgaaccccggacac |
6463035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 6702576 - 6702647
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
6702576 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccagacac |
6702647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 7166297 - 7166226
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | || |||||||||||||||||||| |
|
|
| T |
7166297 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggctggggttcgaaccccggacac |
7166226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 10664864 - 10664794
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10664864 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgca-gagtcggggttcgaaccccggacac |
10664794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 402
Target Start/End: Original strand, 11333665 - 11333736
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||||| | |||||| | ||||| |||||||||||||||||| |
|
|
| T |
11333665 |
ccgtgaacttagctcagttggtagggac-attgcataatttatgcaggggccggagttcgaaccccggacacc |
11333736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 402
Target Start/End: Original strand, 11491686 - 11491757
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||||| | |||||| | ||||| |||||||||||||||||| |
|
|
| T |
11491686 |
ccgtgaacttagctcagttggtagggac-attgcataatttatgcaggggccggagttcgaaccccggacacc |
11491757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 13773180 - 13773239
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
13773180 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaatcccggacac |
13773239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 402
Target Start/End: Complemental strand, 16997328 - 16997257
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||| ||||| || |||||| | |||| ||||||||||||||||||| |
|
|
| T |
16997328 |
ccgtgagcttagctcagttggtagagacaa-tgcatattttatgcaggggccgaggttcgaaccccggacacc |
16997257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 18216906 - 18216977
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | | ||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
18216906 |
cccgtgagcttagctcagttggtagggatat-tacatattttatgcaagagccggggttcgaaccccggacac |
18216977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 19924431 - 19924502
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19924431 |
cccgtgatcttaactcagttggtagggatatc-gcattttatatgcaagagtcggggttcgaaccccggacac |
19924502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 26550494 - 26550565
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
26550494 |
cccgtgagcttaactcagttggtagggatat-tgcatactatatgcaggagccggggttcgaaccccggacac |
26550565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 26584816 - 26584745
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
26584816 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggaggcggggttcgaaccccgcacac |
26584745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 33200038 - 33200110
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||| |||||| | | | |||||||| || ||||||||| |
|
|
| T |
33200038 |
cccgtgagcttagctcagttggtagggacaaatgcataatatatgtaggggtcggggttcaaatcccggacac |
33200110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 33254728 - 33254799
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
33254728 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttggaaccccggacac |
33254799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 33274900 - 33274971
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
33274900 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttggaaccccggacac |
33274971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 40375373 - 40375314
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
40375373 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggtacgaaccccggacac |
40375314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 43884806 - 43884865
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
43884806 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccctggacac |
43884865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 46021918 - 46021878
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46021918 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
46021878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 333 - 401
Target Start/End: Complemental strand, 50824476 - 50824409
Alignment:
| Q |
333 |
tgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| | |||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
50824476 |
tgaacttagttcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
50824409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 402
Target Start/End: Original strand, 3481559 - 3481630
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||| |||||||| | | ||||||| |||||||| |||| |
|
|
| T |
3481559 |
cgtgagcttagctcagttggtagggacaaatgcataatatatgcaaggtctggggttcaaaccccggccacc |
3481630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 400
Target Start/End: Complemental strand, 52833192 - 52833134
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
52833192 |
ctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggaca |
52833134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 2052769 - 2052708
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatttt-atatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| | ||||||| | |||||||||||||||||||||||| |
|
|
| T |
2052769 |
gctcagttggcagggacaa-tgcattatcatatgcaggggccggggttcgaaccccggacacc |
2052708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 5431097 - 5431047
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaac |
392 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | | | |||||||||||| |
|
|
| T |
5431097 |
ctcagttggtaggaacaaatgcattttatatgtaggggtcggggttcgaac |
5431047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 401
Target Start/End: Complemental strand, 6712177 - 6712108
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| |||||||||||||| | | ||||||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
6712177 |
cgtgagcttagctcagttggtaggtatat-tgcattttatatgcaggggccggggttcaaaccccggacac |
6712108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 15368814 - 15368874
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
15368814 |
gctcagttggtagg-acaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
15368874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 398
Target Start/End: Original strand, 25819193 - 25819250
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
25819193 |
gctcagttggcagggacaa-tgcattattatatgtaggagccggggttcgaaccccgga |
25819250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 29491478 - 29491539
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
29491478 |
gctcagttggcagggacaa-tgcattattatatgcaggggtcggggttcgaaccccggacacc |
29491539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 39238724 - 39238785
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
39238724 |
gctcagttggcagggacaa-tgcattattatatgcaggggccgaggttcgaaccccggacacc |
39238785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 40678831 - 40678892
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
40678831 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgatccccggacacc |
40678892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 2754360 - 2754432
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||| |||||||||||| | ||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
2754360 |
cccgtgagcttagcttagttggtagggatat-tgcatattatatgccggggccggggttcgaaccccggacacc |
2754432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 11344437 - 11344510
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||| ||||||||||||||||||||| |||||| | ||||| |||||||||| ||||||| |
|
|
| T |
11344437 |
cccgtgagcttagcttagttggtagggacaaatgcataatatatgtagaggccggagttcgaaccctggacacc |
11344510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 11502457 - 11502530
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||| ||||||||||||||||||||| |||||| | ||||| |||||||||| ||||||| |
|
|
| T |
11502457 |
cccgtgagcttagcttagttggtagggacaaatgcataatatatgtagaggccggagttcgaaccctggacacc |
11502530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 332 - 401
Target Start/End: Original strand, 17580320 - 17580388
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||| ||||||||| || |||||||||||| |||||||| |
|
|
| T |
17580320 |
gtgaacttagctcagttggtaggga-tattgcatgttatatgcagaagtcggggttcgaactccggacac |
17580388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 398
Target Start/End: Original strand, 29188648 - 29188704
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
29188648 |
gctcagttggtagggatat-tgcatattatatgcaggagcaggggttcgaaccccgga |
29188704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 38448930 - 38448858
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||| |||||| ||||| |||||||| | |||||||||||| |||||||||| |
|
|
| T |
38448930 |
cccgtgagcttagctcagttggtaaggacaa-tgcataatatatgcaaggtccggggttcgaatcccggacacc |
38448858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 6130091 - 6130032
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
6130091 |
gctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaactccggacac |
6130032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 402
Target Start/End: Original strand, 7191033 - 7191104
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||| ||| ||||||||| |||||| | ||||| ||||||||| | || ||||||||||||||||||||| |
|
|
| T |
7191033 |
ccgtgaccttagctcagttgatagggatat-tgcatattatatgcaggggctggggttcgaaccccggacacc |
7191104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 12502312 - 12502253
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
12502312 |
gctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaacccggacac |
12502253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 326 - 402
Target Start/End: Original strand, 17283945 - 17284020
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| ||| |||||||||||| |||| ||||||| |||||||| | || |||||||||||| ||||||| |
|
|
| T |
17283945 |
tgtcccgtgagcttagctcagttggtaaggac-aatgcataatatatgcaaggtccagggttcgaaccctggacacc |
17284020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 17671480 - 17671409
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||| ||||||| | ||||| ||||||||||||||||| |
|
|
| T |
17671480 |
cccgtgagcttagctcagttggtagggatatc-gcatttcatatgcaggggccggagttcgaaccccggacac |
17671409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 21247802 - 21247742
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||| |||||||| |||| ||||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
21247802 |
ctcaattggtaggaacaagtgcattttatatgcaggtttcggggttcgaacctcggacacc |
21247742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Complemental strand, 23464056 - 23464012
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
23464056 |
aatgcattattatatgcaggggccggggttcgaaccccggacacc |
23464012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 34580844 - 34580785
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | || || ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
34580844 |
gctcagttggtagggatat-tgtatattatatgcaggagctggggttcgaaccccggacac |
34580785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 40520842 - 40520901
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||| || |||||||||||||| ||||| |
|
|
| T |
40520842 |
gctcagttggtagggatat-tgcatattatatgcatgggctggggttcgaaccccagacac |
40520901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 402
Target Start/End: Complemental strand, 43021691 - 43021620
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||| ||| ||| ||||||||||||||| ||||| || |||||| | | ||||||||||||| |||||||| |
|
|
| T |
43021691 |
ccgtgagcttagcttagttggtagggacaa-tgcatattttatgcaggggtcggggttcgaacctcggacacc |
43021620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 3e-24; HSPs: 60)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 337 - 402
Target Start/End: Original strand, 46645716 - 46645781
Alignment:
| Q |
337 |
ctttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
46645716 |
ctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
46645781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 337 - 402
Target Start/End: Original strand, 13702032 - 13702097
Alignment:
| Q |
337 |
ctttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
13702032 |
ctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcaaaccccggacacc |
13702097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 326 - 402
Target Start/End: Original strand, 46758238 - 46758314
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||| | | |||||||||||| ||||||||| |
|
|
| T |
46758238 |
tgtcccgtgagctctgctcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaactccggacacc |
46758314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 402
Target Start/End: Original strand, 34891216 - 34891278
Alignment:
| Q |
340 |
tgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
34891216 |
tgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaactccggacacc |
34891278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 328 - 396
Target Start/End: Original strand, 40200715 - 40200783
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccg |
396 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
40200715 |
tcccgtgagctttgttcagttggtagggacaaatgtattttatatgcaggggccggggttcgaaccccg |
40200783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 29617405 - 29617476
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29617405 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
29617476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 330 - 394
Target Start/End: Original strand, 41853640 - 41853704
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccc |
394 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
41853640 |
ccgtgagcttagctcagttggtagagacaaatgcatgttatatgcaagagtcggggttcgaaccc |
41853704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 343 - 402
Target Start/End: Complemental strand, 20101709 - 20101650
Alignment:
| Q |
343 |
tcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
20101709 |
tcagttggtatggacaaatgcatattatatgcaggggccggggttcgaactccggacacc |
20101650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 401
Target Start/End: Original strand, 36174391 - 36174461
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
36174461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 328 - 398
Target Start/End: Original strand, 24781029 - 24781098
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
24781029 |
tcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccgga |
24781098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 9877337 - 9877265
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
9877337 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
9877265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 10244959 - 10244887
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
10244959 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgtaggagccggggttcgaaccccggacacc |
10244887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 23102628 - 23102556
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
23102628 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
23102556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 47440869 - 47440808
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | | |||||||||||||| ||||||| |
|
|
| T |
47440869 |
gctcagttggtagggacaaatgcataatatatgcaggggtcggggttcgaaccctggacacc |
47440808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 2681096 - 2681167
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2681096 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
2681167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 3766811 - 3766882
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3766811 |
cccgtgagcttaactcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
3766882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 12640659 - 12640588
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
12640659 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccagacac |
12640588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 15238889 - 15238960
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
15238889 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacac |
15238960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 21388535 - 21388594
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21388535 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
21388594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 31026231 - 31026290
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31026231 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
31026290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 32677000 - 32676941
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32677000 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
32676941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 35950128 - 35950199
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35950128 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
35950199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 36391974 - 36391903
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
36391903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 42443689 - 42443760
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
42443689 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaatcccggacac |
42443760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 339 - 402
Target Start/End: Complemental strand, 1563799 - 1563737
Alignment:
| Q |
339 |
ttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
1563799 |
ttgctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
1563737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 401
Target Start/End: Original strand, 8174129 - 8174187
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8174129 |
ctcagttggtagggatat-tgcattttatatgcaggagctggggttcgaaccccggacac |
8174187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 21285440 - 21285379
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
21285440 |
gctcagttggcagggacaa-tgcattgttatatgcaggggccggggttcgaaccccggacacc |
21285379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 326 - 392
Target Start/End: Original strand, 33590444 - 33590510
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaac |
392 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||| |||||||||||| | ||| ||||||||| |
|
|
| T |
33590444 |
tgtcccgtgagcttagctcagttggtagggacaaatatattttatatgcaggggccatggttcgaac |
33590510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 27510328 - 27510256
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
27510328 |
tcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgatccccgtacac |
27510256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 34267622 - 34267550
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||| | | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
34267622 |
tcccgtgagcttagctcagttggtaggaatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
34267550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 401
Target Start/End: Original strand, 48119473 - 48119541
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||| ||| |||||||||||||||| | ||||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
48119473 |
gtgagcttagctcagttggtagggatat-tgcattttatatgcaggggccgaggttcgaaccccggacac |
48119541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 402
Target Start/End: Original strand, 11808034 - 11808107
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||| |||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
11808034 |
tcccgtgagcttagctcaattggtagggaca--tgcattgttatatgcaggggtcggggttcgaaccccggacacc |
11808107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 394
Target Start/End: Original strand, 12264055 - 12264118
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccc |
394 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||||||||||||| | ||||| |||||||||| |
|
|
| T |
12264055 |
ccgtgaacttagctcagttggtaggga-tattgcattttatatgcaggggccggagttcgaaccc |
12264118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 19753038 - 19752967
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||| |||||| |
|
|
| T |
19753038 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccctggacac |
19752967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 24061399 - 24061328
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||| | | ||||| ||||||||| |||||||||||||||||||| |||| |
|
|
| T |
24061399 |
cccgtgagcttagctcagttggtaggaatat-tgcatattatatgcaggagccggggttcgaaccccgaacac |
24061328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 26801768 - 26801728
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26801768 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
26801728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 36469775 - 36469704
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | | ||| ||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
36469775 |
cccgtgagcttagctcagttggtagggatat-tacatattacatgcaggagccggggttcgaaccccggacac |
36469704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 44616602 - 44616673
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||| || ||||||||| |
|
|
| T |
44616602 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcaaaacccggacac |
44616673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 398
Target Start/End: Original strand, 12772117 - 12772183
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||| ||| |||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
12772117 |
cgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccgga |
12772183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 401
Target Start/End: Complemental strand, 30388575 - 30388506
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccagacac |
30388506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 391
Target Start/End: Original strand, 36622174 - 36622235
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaa |
391 |
Q |
| |
|
||||||||||| ||||| |||||||||| | ||||| ||||||||||| ||||||||||||| |
|
|
| T |
36622174 |
cccgtgaacttagctcaattggtagggatat-tgcatattatatgcatgggccggggttcgaa |
36622235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 402
Target Start/End: Original strand, 46987086 - 46987155
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||| ||| |||||||||||| |||||| ||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
46987086 |
gtgagcttagctcagttggtaaggacaa-tgcataatatatgcaaggtccggggttcgaaccccggacacc |
46987155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 47552222 - 47552282
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
47552222 |
gctcagttggtagg-acaa-tgcattattatatgcaagggccggggttcgaaccccggacacc |
47552282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 335 - 401
Target Start/End: Original strand, 48719805 - 48719870
Alignment:
| Q |
335 |
aactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| |||||||||||||| | | ||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
48719805 |
aacttagctcagttggtaggaatat-tgcatattatatgcaggagccggggttcgaaccccagacac |
48719870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 402
Target Start/End: Original strand, 32047120 - 32047161
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
32047120 |
tgcatgttatatgcaggggccggggttcgaaccccggacacc |
32047161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 35683198 - 35683126
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | |||||||||||||| | | |||||||||||| |||||||| |
|
|
| T |
35683198 |
tcccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggggtcggggttcgaactccggacac |
35683126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 36389736 - 36389664
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | || |||||||||||| | ||||| |||||||| ||||||||| |
|
|
| T |
36389736 |
cccgtgagcttagctcagttggtagggatat-tgtattttatatgcaggggccggagttcgaactccggacacc |
36389664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 402
Target Start/End: Original strand, 7465462 - 7465535
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| | | |||||||||| || |||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
7465462 |
tcccgtgagcatagctcagttggcagagaca--tgcattattatatgcaggggccggggttcgaaccccggacacc |
7465535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 9712255 - 9712196
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
9712255 |
ctcagttggtagggatat-tgcatattatatgcaggggtcggggttcgaaccccggacacc |
9712196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 13720770 - 13720841
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| || ||||||||||| |||| | ||||| ||||||||| | |||||||||||||||||| |||| |
|
|
| T |
13720770 |
cccgtgaagttagctcagttggttgggatat-tgcatattatatgcaggggccggggttcgaaccccgaacac |
13720841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 24880510 - 24880451
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | || || ||||||||| |||||||||||||||||||| |||| |
|
|
| T |
24880510 |
gctcagttggtagggatat-tgaatattatatgcaggagccggggttcgaaccccgaacac |
24880451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 25318575 - 25318535
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||| |||| |
|
|
| T |
25318575 |
tgcattttatatgtaggagccggggttcgaaccccgaacac |
25318535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Complemental strand, 29658342 - 29658298
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
29658342 |
aatgcattgttatatgcaggggccggggttcgaaccccggacacc |
29658298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 32619381 - 32619421
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
32619381 |
tgcatattatatgtaggagccggggttcgaaccccggacac |
32619421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 33996939 - 33996880
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
33996939 |
gctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccctggacac |
33996880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Complemental strand, 34960990 - 34960946
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
34960990 |
aatgcattattatatgcaggagccggggttcgaatcccggacacc |
34960946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 35645611 - 35645670
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | || || ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
35645611 |
gctcagttggtagggatat-tgtatattatatgcaggagccggggttcgaaccctggacac |
35645670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Complemental strand, 44437895 - 44437851
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44437895 |
aatgcattattatatgcaggggccggggttcgaaccccggacacc |
44437851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 47255121 - 47255081
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
47255121 |
tgcatattatctgcaggagccggggttcgaaccccggacac |
47255081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 47999780 - 47999851
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||| | |||| |||||||||| ||||||||| |
|
|
| T |
47999780 |
cccgtgagcttagctcagttggtaggga-tattgcatattatatgtaggagctggggttcgaatcccggacac |
47999851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 3e-24; HSPs: 81)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 36099254 - 36099181
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
36099254 |
cccgtgagctttgctcaattggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacacc |
36099181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 328 - 402
Target Start/End: Original strand, 30305797 - 30305871
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
30305797 |
tcccgtgagctttgctcagttggtatggacaaatgcattttatatgcaggggctggggttcgaaccccggacacc |
30305871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 337 - 402
Target Start/End: Complemental strand, 23176784 - 23176719
Alignment:
| Q |
337 |
ctttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
23176784 |
ctttgctcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaaccccggacacc |
23176719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 28715689 - 28715761
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
28715689 |
cccgtgagctttgctcagttgatagagacaaatgcattttatatgcaggggccggggttcgaaccccggacac |
28715761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 7513452 - 7513380
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||| | | | ||||||||||||||||||| |
|
|
| T |
7513452 |
cccgtgagctttgctcagttggtagggacaaatgtattttatatgcaggggtcagggttcgaaccccggacac |
7513380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 327 - 399
Target Start/End: Complemental strand, 23142826 - 23142754
Alignment:
| Q |
327 |
gtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggac |
399 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||| | | || |||||||||||| ||||| |
|
|
| T |
23142826 |
gtcccgtgagcttagctcagttggtagggacaaatgcattttatatgtaggggctggggttcgaacctcggac |
23142754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 22230505 - 22230433
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22230505 |
tcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
22230433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 6371114 - 6371185
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6371114 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
6371185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 332 - 392
Target Start/End: Original strand, 32898439 - 32898499
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaac |
392 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
32898439 |
gtgagcttagctcagttggtagggacaaatgcattttatatgtaggggccggggttcgaac |
32898499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 43147454 - 43147383
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43147454 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
43147383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 43596895 - 43596966
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43596895 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
43596966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 46105535 - 46105606
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46105535 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
46105606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 46775100 - 46775029
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46775100 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
46775029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 55251421 - 55251350
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55251421 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
55251350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 8965094 - 8965166
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
8965094 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
8965166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 395
Target Start/End: Complemental strand, 45665105 - 45665036
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaacccc |
395 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||| |||||||| | |||| ||||||||||| |
|
|
| T |
45665105 |
tgtcccgtgaatttagctcagttggtagggacaaatgcataatatatgcagggaccggtgttcgaacccc |
45665036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 49056787 - 49056847
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
49056787 |
gctcagttggtagggacat-tgcatattatatgcaggagccggagttcgaaccccggacacc |
49056847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 49901482 - 49901554
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
49901482 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
49901554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 3847681 - 3847752
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
3847681 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgatccccggacac |
3847752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 5179952 - 5179881
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||| ||||||||||| ||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5179952 |
cccgtgaacttaactcagttggtaaggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
5179881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 45112181 - 45112110
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45112181 |
cccgtgagcttacctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
45112110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 55055916 - 55055987
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||||| ||||||| || |||||| | |||| |||||||||||||||||| |
|
|
| T |
55055916 |
cccgtgagcttagctcagttggtagggac-aatgcatattttatgcaggggccgaggttcgaaccccggacac |
55055987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 329 - 372
Target Start/End: Original strand, 3161021 - 3161064
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatat |
372 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3161021 |
cccgtgagcttagctcagttggtagggacaaatgcattttatat |
3161064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 362 - 401
Target Start/End: Complemental strand, 35948220 - 35948181
Alignment:
| Q |
362 |
gcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35948220 |
gcattttatatgcaggagccggggttcgaaccccggacac |
35948181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 326 - 392
Target Start/End: Complemental strand, 40200857 - 40200792
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaac |
392 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
40200857 |
tgtcccgtgaacattgctcagttggta-ggac-aatgcattattatatgcatgatccggggttcgaac |
40200792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 402
Target Start/End: Original strand, 1439617 - 1439690
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||| |||||||||||| |||| | ||||| ||||||||| | | ||||||||||||||| |||||| |
|
|
| T |
1439617 |
tcccgtgaacttagctcagttggtatggac-attgcatattatatgcaagggtcggggttcgaaccccagacacc |
1439690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 14149801 - 14149862
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
14149801 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
14149862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 28520818 - 28520757
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
28520818 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
28520757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 329 - 395
Target Start/End: Original strand, 44602485 - 44602550
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaacccc |
395 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
44602485 |
cccgtgagcttagctcagttggtagggatat-tgcattttatatgcaggggccggggttcgaacccc |
44602550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 11375959 - 11375887
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||| |||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
11375959 |
cccgtgagcttagctcagttgatagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
11375887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 21935489 - 21935549
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
21935489 |
gctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
21935549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 42231511 - 42231583
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| ||||||||||||| | | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42231511 |
tcccgtgagcttaactcagttggtaggaatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
42231583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 326 - 402
Target Start/End: Complemental strand, 47018047 - 47017972
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||||||||| |||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
47018047 |
tgtcccgtgagcatagctcagttggtagg-acaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
47017972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 56088012 - 56087952
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
56088012 |
gctcagttggtagggatat-tgcattttatatgcaggggccggggttcgaatcccggacacc |
56087952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 627040 - 626981
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
627040 |
gctcagttggtagggatat-tgcatattatatgcaagagctggggttcgaaccccggacac |
626981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 637130 - 637170
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
637130 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
637170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 1458057 - 1458017
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1458057 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
1458017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 4234355 - 4234284
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||| |||||| | ||||| ||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
4234355 |
cccgtgagcttagctcagttgatagggatat-tgcatattatatgcaggagccggggttcgaacctcggacac |
4234284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 4958626 - 4958555
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| | |||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4958626 |
cccgtgagcttagttcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
4958555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 7686332 - 7686261
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||| || | ||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
7686332 |
cccgtgagcttagctcagttggtagagatat-tgcattttatatgcaggggccggggttcgaaccctggacac |
7686261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 9761115 - 9761186
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
9761115 |
cccgtgagcttacctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
9761186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 12582067 - 12582027
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12582067 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
12582027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 17617019 - 17616979
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17617019 |
tgcattttatatgcaggggccggggttcgaaccccggacac |
17616979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 18360493 - 18360564
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18360493 |
cccgtgagcttagctcagttggtagggatatca-cattttatatgcaggggccggggttcgaaccccggacac |
18360564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 23705223 - 23705152
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
23705223 |
cccgtgagcttagctcagttggtagggatat-tgcatattacatgcaggagctggggttcgaaccccggacac |
23705152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 26868349 - 26868419
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
26868349 |
cccgtgagcttagctcagttggtaggga-tattgcatattatatgcaggagcc-gggttcgaaccccggacac |
26868419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 26919538 - 26919467
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
26919538 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaactccggacac |
26919467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 36602436 - 36602365
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
36602436 |
cccgtgagcttagctcagttggtagggatatca-cattttatatgcaggggccggggttcgaaccccggacac |
36602365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 47934142 - 47934071
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
47934142 |
cccgtgagcttagctcagttggtagggatatg-gcatattatatgcaggggccggggttcgaaccccggacac |
47934071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 343 - 402
Target Start/End: Complemental strand, 48968295 - 48968236
Alignment:
| Q |
343 |
tcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
48968295 |
tcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
48968236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 52731478 - 52731438
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52731478 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
52731438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 398
Target Start/End: Original strand, 3815059 - 3815128
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
|||||||| ||| ||| |||||||||||| | ||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
3815059 |
tcccgtgagcttagcttagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccgga |
3815128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 9692970 - 9693031
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| ||||| || |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
9692970 |
gctcagttggcagggataa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
9693031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 402
Target Start/End: Original strand, 19854565 - 19854634
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||| ||| |||||||||||| |||||| ||||| |||||||| || |||||||||||||| |||||||| |
|
|
| T |
19854565 |
gtgagcttagctcagttggtatggacaa-tgcataatatatgcaagatccggggttcgaacctcggacacc |
19854634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 402
Target Start/End: Complemental strand, 20753226 - 20753151
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||||||||| | |||||||| ||||||| | | |||||||||||||||||||||||| |
|
|
| T |
20753226 |
tgtcccgtgagcatagctcagttggtaggaa--aatgcattattatatgtaggggccggggttcgaaccccggacacc |
20753151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 400
Target Start/End: Original strand, 27921892 - 27921963
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
|||||||| | | |||||||||||||||||| |||||| ||||||||| | ||||||||||||||||| |||| |
|
|
| T |
27921892 |
tcccgtgagcatagctcagttggtagggaca--tgcattattatatgcaggggccggggttcgaaccccagaca |
27921963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 36008283 - 36008344
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
36008283 |
gctcagttggcagggacaa-tgcattgttatatgcaggggccggggttcgaaccccgaacacc |
36008344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 367 - 401
Target Start/End: Complemental strand, 46998401 - 46998367
Alignment:
| Q |
367 |
ttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46998401 |
ttatatgcaggagccggggttcgaaccccggacac |
46998367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 53815704 - 53815765
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | || ||||||||||||||||||||| |
|
|
| T |
53815704 |
gctcagttggcagggacaa-tgcattattatatgcaggggctggggttcgaaccccggacacc |
53815765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 402
Target Start/End: Original strand, 2222570 - 2222611
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
2222570 |
tgcatgttatatgcaggggccggggttcgaaccccggacacc |
2222611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 3036125 - 3036053
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
3036125 |
cccgtgagcttaactcagttggtagggatat-tgcatattatatgcaggggccgaggttcgaaccccggacacc |
3036053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 13264332 - 13264272
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13264332 |
gctcagttggtagggatat-tgcatattatatgcaaggaccggggttcgaaccccggacacc |
13264272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 402
Target Start/End: Complemental strand, 26347105 - 26347064
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26347105 |
tgcatgttatatgcaagggccggggttcgaaccccggacacc |
26347064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 33933809 - 33933737
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||||| | ||||| |||||||| | |||||||||||| ||| ||||||| |
|
|
| T |
33933809 |
cccgtgagcttagctcagttggtagggac-attgcataatatatgcaggggccggggttcgacccctggacacc |
33933737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 364 - 401
Target Start/End: Complemental strand, 48825854 - 48825817
Alignment:
| Q |
364 |
attttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
48825854 |
attttatatgcaggagccggggttagaaccccggacac |
48825817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 50457785 - 50457713
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||| ||| | ||||| ||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
50457785 |
tcccgtgagcttagctcagttggtaaggatat-tgcatattatatgcaggggccagggttcgaaccccggacac |
50457713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 51890797 - 51890869
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||| ||||||| ||||| | |||||| | |||||||||||||||||||||||| |
|
|
| T |
51890797 |
cccgtgagcttagctcagttggcagggacat-tgcataatttatgcaggggccggggttcgaaccccggacacc |
51890869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 13578522 - 13578463
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
13578522 |
ctcagttggtagggatat-tgcatattatatgcaggggtcggggttcgaaccccggacacc |
13578463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 23924942 - 23924871
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||| | |||||| | ||||||||||||||||||||||| |
|
|
| T |
23924942 |
cccgtgaacttaactcaattggtagggacat-tgcataatttatgcaggggccggggttcgaaccccggacac |
23924871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 35219570 - 35219500
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
35219570 |
cccgtgagcttagctcagttggtagggatat-tgcatatta-atgcaggagtcggggttcgaaccccggacac |
35219500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 36132260 - 36132300
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
36132260 |
tgcatattatatgcaggagtcggggttcgaaccccggacac |
36132300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 39023175 - 39023246
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | | |||||||||||||| |||||| |
|
|
| T |
39023175 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggtcggggttcgaaccctggacac |
39023246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 400
Target Start/End: Original strand, 46206580 - 46206647
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
|||| ||| |||||||||||||||||| |||||| |||||||| | | |||| ||||||||||||||| |
|
|
| T |
46206580 |
gtgagcttagctcagttggtagggacat-tgcattatatatgcaggggtcgggattcgaaccccggaca |
46206647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 46582646 - 46582705
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
46582646 |
gctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccagacac |
46582705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 48569246 - 48569175
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | || |||||||||||||| ||||| |
|
|
| T |
48569246 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggctggggttcgaaccccagacac |
48569175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 398
Target Start/End: Complemental strand, 48615529 - 48615474
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
48615529 |
ctcagttggtagggatat-tgcatattatatgcagaagccggggttcgaaccccgga |
48615474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 48798279 - 48798349
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||||||||| ||| | || |||||||||||||||||||| |
|
|
| T |
48798279 |
cccgtgagcttagctcagttggtaggga-tattgcattttata-gcaggggctggggttcgaaccccggacac |
48798349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 49757323 - 49757283
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
49757323 |
tgcatattatatgcaggagccggggttcgaaccctggacac |
49757283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 51512067 - 51512008
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
51512067 |
gctcagttggtagggatat-tgcatattatatgctgtagccggggttcgaaccccggacac |
51512008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 53376718 - 53376678
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
53376718 |
tgcatgttatatgcaagggccggggttcgaaccccggacac |
53376678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Complemental strand, 53698050 - 53698006
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
53698050 |
aatgcattattatatgcaggggccggggttcgaaccccggacacc |
53698006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 61)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 10463268 - 10463195
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
10463268 |
cccgtgagcttagctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccgaacacc |
10463195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 32220966 - 32221039
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
32220966 |
cccgtgagctttgctcagttggttgggacaaatgcattttatatgcaggggccggggttcgaacctcggacacc |
32221039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 326 - 402
Target Start/End: Original strand, 5947862 - 5947938
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
5947862 |
tgtcccgtgagctctgctcggttggtagggacaaatgcattttatatgcaggggtcggggttcgaaccccggacacc |
5947938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 20497266 - 20497193
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| | | || |||||||||| |||||||||| |
|
|
| T |
20497266 |
cccgtgagctttgctcagttggtagggacaaatgcattttatatgtaggggctggggttcgaatcccggacacc |
20497193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 23984294 - 23984221
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
23984294 |
cccgtgagcttagctcaattggtagggacaaatgcattttatatgcaggggccagggttcgaaccccggacacc |
23984221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 333 - 402
Target Start/End: Original strand, 32854535 - 32854604
Alignment:
| Q |
333 |
tgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| | ||| |||||||||| |||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
32854535 |
tgaacttagttcaattggtagggataaatgcattttatatgcaagggccggggttcgaaccccggacacc |
32854604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 30390439 - 30390367
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| || |||||||||||||||| | ||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30390439 |
cccgtgaatttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacacc |
30390367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 402
Target Start/End: Original strand, 18254601 - 18254661
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| | |||||||||||||| || |||||| |
|
|
| T |
18254601 |
ctcagttggtagggataaatgcattttatatgcaggggccggggttcgaactccagacacc |
18254661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 401
Target Start/End: Original strand, 41509517 - 41509587
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
41509587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 3446730 - 3446802
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
3446730 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacacc |
3446802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 33229003 - 33228931
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
33229003 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
33228931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 349 - 402
Target Start/End: Original strand, 36101678 - 36101731
Alignment:
| Q |
349 |
ggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||| ||||||||| | || ||||||||||||||||||||| |
|
|
| T |
36101678 |
ggtagggacaaatgcatattatatgcaggggctggggttcgaaccccggacacc |
36101731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 2643709 - 2643768
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2643709 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
2643768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 4562810 - 4562751
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4562810 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
4562751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 19281608 - 19281679
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
19281608 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
19281679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 22653714 - 22653643
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
22653714 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
22653643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 34613979 - 34614050
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
34613979 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacac |
34614050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 44822423 - 44822494
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
44822423 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggagccggggttcgaaccccagacac |
44822494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 343 - 401
Target Start/End: Complemental strand, 7717662 - 7717604
Alignment:
| Q |
343 |
tcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | | |||||||||||| ||||||| |
|
|
| T |
7717662 |
tcagttggtagggacaaatgtattttatatgcaggggtcggggttcgaacttcggacac |
7717604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 11133084 - 11133145
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
11133084 |
gctcagttggtagggacaa-tgcattgttatatgcaggggtcggggttcgaaccccggacacc |
11133145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 347 - 393
Target Start/End: Original strand, 14518301 - 14518347
Alignment:
| Q |
347 |
ttggtagggacaaatgcattttatatgcatgagccggggttcgaacc |
393 |
Q |
| |
|
|||||||||||||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
14518301 |
ttggtagggacaaatgcattttgtatgcaggggccggggttcgaacc |
14518347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 331 - 401
Target Start/End: Original strand, 36182644 - 36182713
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| |||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagcaggggttcgaaccccggacac |
36182713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 326 - 402
Target Start/End: Complemental strand, 580884 - 580809
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||||||||| |||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
580884 |
tgtcccgtgagcatagctcagttggtagg-acaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
580809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 1071470 - 1071541
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||| ||| | || || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1071470 |
cccgtgagcttagctcagttggtatggatat-tgtatattatatgcaggagccggggttcgaaccccggacac |
1071541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 3438960 - 3439019
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3438960 |
gctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
3439019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 4183176 - 4183247
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
4183176 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccgaacac |
4183247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 8250371 - 8250300
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
8250371 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccagacac |
8250300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 18278475 - 18278416
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
18278475 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaatcccggacac |
18278416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 20296449 - 20296489
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20296449 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
20296489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 25857365 - 25857294
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
25857365 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaacaccggacac |
25857294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 39408760 - 39408689
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
39408760 |
cccgtgagcttaactcagttggtagggatat-tgcatattatatgcaagagccggggttcgaaccccagacac |
39408689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 40535519 - 40535448
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||| ||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40535519 |
cccgtgagcttagctcagttggtacggatat-tgcatattatatgcaggggccggggttcgaaccccggacac |
40535448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 330 - 401
Target Start/End: Original strand, 17487705 - 17487775
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
17487705 |
ccgtgaacttagctcagttggtaggga-tattgcatattatatgcagtggctggggttcgaaccccggacac |
17487775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 329 - 396
Target Start/End: Original strand, 19684073 - 19684139
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccg |
396 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
19684073 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccg |
19684139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 327 - 402
Target Start/End: Original strand, 28771577 - 28771651
Alignment:
| Q |
327 |
gtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| || |||||||||||| |||||| ||||| |||||||| || ||| ||||||||||||||||||| |
|
|
| T |
28771577 |
gtcccgtgagtttagctcagttggtaaggacaa-tgcataatatatgcaagatccgcggttcgaaccccggacacc |
28771651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 402
Target Start/End: Original strand, 5612957 - 5613026
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||| ||| |||||||||| ||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatat-tgcatattatatgcaagggccggggttcgaaccccggacacc |
5613026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 29034984 - 29035045
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| |||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
29034984 |
gctcacttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
29035045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 401
Target Start/End: Complemental strand, 40688707 - 40688638
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| ||||||||||||| || | ||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
40688707 |
cgtgatcttagctcagttggtagagatat-tgcattttatatgcaggggccagggttcgaaccccggacac |
40688638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 401
Target Start/End: Original strand, 40864401 - 40864470
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| |||||||||||||| | | ||||||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
40864401 |
cgtgagcttagctcagttggtaggaatat-tgcattttatatgcaggggccggggttcgaacaccggacac |
40864470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 401
Target Start/End: Complemental strand, 44857302 - 44857233
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| |||||||||||||||| | ||||| ||||||||| | |||| |||||||||||||||||| |
|
|
| T |
44857302 |
cgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccgaggttcgaaccccggacac |
44857233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 1844829 - 1844889
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
1844829 |
gctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaacctcggacacc |
1844889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 3037708 - 3037648
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
3037708 |
ctcagttggctgggacaa-tgcattgttatatgcaggggccggggttcgaaccccggacacc |
3037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 5474906 - 5474978
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||| ||||| | ||||| ||||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
5474906 |
cccgtgagcttagctcagttggcagggatat-tgcatattatacgcaggagccggggttcgaactccggacacc |
5474978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 20919610 - 20919682
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||||| ||||| | ||||| | |||||||||||||||||||||||| |
|
|
| T |
20919610 |
cccgtgagcttagctcagttggtagggacat-tgcataatttatgctggggccggggttcgaaccccggacacc |
20919682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 23405196 - 23405268
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||||| | ||||| |||||||| | | |||||||||||||| ||||||| |
|
|
| T |
23405196 |
cccgtgagcttagctcagttggtagggac-attgcataatatatgcaggggtcggggttcgaaccctggacacc |
23405268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 24202146 - 24202219
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||| |||||| || |||||||| | |||||| | |||||||||||||||||||||||| |
|
|
| T |
24202146 |
cccgtgagcttagctcacttggtaagggataatgcattatgtatgcaggggccggggttcgaaccccggacacc |
24202219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 393
Target Start/End: Original strand, 27449182 - 27449246
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaacc |
393 |
Q |
| |
|
|||||||| | | |||||||||||||||| | ||||||||||||||||| | ||||||||||||| |
|
|
| T |
27449182 |
tcccgtgagcatagctcagttggtagggatat-tgcattttatatgcatgggtcggggttcgaacc |
27449246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 400
Target Start/End: Complemental strand, 32527177 - 32527105
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
|||||| ||| | |||||||||| |||||||| |||||| ||||||||| | ||||||||||||||||| |||| |
|
|
| T |
32527177 |
tcccgtaaacatagctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccagaca |
32527105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 1309165 - 1309125
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
1309165 |
tgcatattatatgcaggagctggggttcgaaccccggacac |
1309125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 6331574 - 6331632
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
6331574 |
gctcagttggtagggatat-tgcatattatatgcaggagccggg-ttcgaaccccggacac |
6331632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 17034735 - 17034806
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||| |||||||||| | ||||| ||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
17034735 |
cccgtgagcttagctcaattggtagggatat-tgcatattatatgcaggagtcggggttcgaatcccggacac |
17034806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 17078457 - 17078528
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | || || ||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
17078457 |
cccgtgagcttagctcagttggtagggatat-tgtatattatatgcaggagtcggggttcgaatcccggacac |
17078528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Original strand, 17154674 - 17154718
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
17154674 |
aatgcattattatatgcaggggccggggttcgaaccccggacacc |
17154718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 18803242 - 18803282
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
18803242 |
tgcatattatatgcaagagccggggttcgaaccctggacac |
18803282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 27297175 - 27297246
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| || |||||| |||| ||| |||||||||||||||| |
|
|
| T |
27297175 |
cccgtgagcttagctcagttggtagggatat-tgcatattgtatgcaggagctgggattcgaaccccggacac |
27297246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 402
Target Start/End: Complemental strand, 28153199 - 28153140
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| || |||||||||||||||||||||| |
|
|
| T |
28153199 |
ctcagttggtagggatat-tgcatgttatatgcaggattcggggttcgaaccccggacacc |
28153140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 401
Target Start/End: Original strand, 36005473 - 36005513
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
36005473 |
tgcatattatatgcaggagccggggttcgaaccccagacac |
36005513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 38179303 - 38179244
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| | || |||||||||||| ||||||| |
|
|
| T |
38179303 |
gctcagttggtagggatat-tgcattttatatgcaggggctggggttcgaacctcggacac |
38179244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 38557293 - 38557222
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | |||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
38557293 |
cccgtgagcttaactcagttggtagggatatg-gcattttatatgcaggggtcggggttcgaaccccggacac |
38557222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Original strand, 43870978 - 43871022
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
43870978 |
aatgcattattatatgcaggagccggggttcgaatcccggacacc |
43871022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 44948596 - 44948667
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||| |||||| |
|
|
| T |
44948596 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcagggaccggggttcgaaccctggacac |
44948667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 2e-19; HSPs: 80)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 31024293 - 31024366
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||| ||| | || ||||||||||||||||||||| |
|
|
| T |
31024293 |
cccgtgagctttgctcagttggtagggacaaattcattttatacgcaggggctggggttcgaaccccggacacc |
31024366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 329 - 400
Target Start/End: Original strand, 8183318 - 8183390
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaa-tgcattttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
8183318 |
cccgtgagctttgctcagttggtagggacaaaatgcattttatatgcaggggccggggttcgaaccccagaca |
8183390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 338 - 402
Target Start/End: Original strand, 33810648 - 33810712
Alignment:
| Q |
338 |
tttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
33810648 |
tttgttcagttggtagggaccaatgcattttatatgcaggggccggggttcaaaccccggacacc |
33810712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 329 - 400
Target Start/End: Original strand, 37708690 - 37708761
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
||||||| ||| ||||| |||||||||| || ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
37708690 |
cccgtgagcttagctcaattggtagggataagtgcattttatatgcaggggccggggttcgaaccccggaca |
37708761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 10736944 - 10736873
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10736944 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
10736873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 14876672 - 14876601
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| || ||||| ||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
14876672 |
cccgtgagcttagctcagttggtaggga-aattgcatattatatgcaggagccggggttcgaacctcggacac |
14876601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 29716860 - 29716931
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29716860 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
29716931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 34413062 - 34413133
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34413062 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
34413133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 401
Target Start/End: Complemental strand, 2787150 - 2787080
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
2787080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 329 - 375
Target Start/End: Complemental strand, 38730626 - 38730580
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgca |
375 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38730626 |
cccgtgagctttgctcagttggtaggaacaaatgcattttatatgca |
38730580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 22274669 - 22274609
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22274669 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacacc |
22274609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 94581 - 94510
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
94581 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggagttcgaaccccggacac |
94510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 6280480 - 6280551
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | || || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6280480 |
cccgtgagcttagctcagttggtagggatat-tgaatattatatgcaggagccggggttcgaaccccggacac |
6280551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 6659301 - 6659360
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6659301 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
6659360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 6739703 - 6739762
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6739703 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
6739762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 11875886 - 11875957
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
11875886 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
11875957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 11890893 - 11890964
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
11890893 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
11890964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 17698522 - 17698593
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
17698522 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaatcccggacac |
17698593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 23178961 - 23178890
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
23178961 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacac |
23178890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 28909465 - 28909536
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
28909465 |
cccgtgagcttagctcagttggtagggatat-tgcatattacatgcaggagccggggttcgaaccccggacac |
28909536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 37717363 - 37717434
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37717363 |
cccgtgagcttaactcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
37717434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 43284024 - 43283965
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43284024 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
43283965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 43856452 - 43856381
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
43856452 |
cccgtgagcttaactcagttggtagggatat-tgcattttatatgcaggggccggggttcgaaccccggacac |
43856381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 330 - 401
Target Start/End: Complemental strand, 16432197 - 16432127
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||| ||||||| |
|
|
| T |
16432197 |
ccgtgaacttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaacatcggacac |
16432127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 2800027 - 2800088
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
2800027 |
gctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
2800088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 343 - 401
Target Start/End: Original strand, 7194276 - 7194333
Alignment:
| Q |
343 |
tcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7194276 |
tcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
7194333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 331 - 401
Target Start/End: Complemental strand, 10200749 - 10200680
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| ||||||||||||| || | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10200749 |
cgtgagcttagctcagttggtagagatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
10200680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 14142788 - 14142838
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaac |
392 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | | |||||||||||| |
|
|
| T |
14142788 |
ctcagttggtagggacaaatgcatattatatgcaggggtcggggttcgaac |
14142838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 14146225 - 14146275
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaac |
392 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | | |||||||||||| |
|
|
| T |
14146225 |
ctcagttggtagggacaaatgcatattatatgcaggggtcggggttcgaac |
14146275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 402
Target Start/End: Original strand, 2696542 - 2696602
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
2696542 |
ctcagttggcagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
2696602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 5328625 - 5328565
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
5328625 |
gctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
5328565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 326 - 402
Target Start/End: Original strand, 17980276 - 17980351
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||||||||| ||||| ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
17980276 |
tgtcccgtgagcatagctcagttggtagg-acaaa-gcattattatatgcaggggccggggttcgaaccccggacacc |
17980351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 327 - 396
Target Start/End: Complemental strand, 34158729 - 34158661
Alignment:
| Q |
327 |
gtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccg |
396 |
Q |
| |
|
||||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
34158729 |
gtcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggaggcggggttcgaaccccg |
34158661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 34894381 - 34894441
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
34894381 |
gctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
34894441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 1337154 - 1337114
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1337154 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
1337114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 1937310 - 1937381
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
1937310 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggaggcggggttcgaaccccgcacac |
1937381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 2792779 - 2792850
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||| |||||| | ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2792779 |
cccgtgagcttagctcagttgatagggatat-tgcatattatatgcaggggccggggttcgaaccccggacac |
2792850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 6942570 - 6942530
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6942570 |
tgcatattatatgcaggagccggggttcgaaccccggacac |
6942530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 7797142 - 7797201
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | || || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7797142 |
gctcagttggtagggatat-tgaatattatatgcaggagccggggttcgaaccccggacac |
7797201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 401
Target Start/End: Complemental strand, 10594255 - 10594215
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10594255 |
tgcattttatatgcaggagccggggttcgaaccccgtacac |
10594215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 402
Target Start/End: Original strand, 14583209 - 14583269
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | || |||||||||||| || ||||| |
|
|
| T |
14583209 |
ctcagttggtagggacaaatgcataatatatgcaggggctggggttcgaaccacgaacacc |
14583269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 327 - 402
Target Start/End: Complemental strand, 15042465 - 15042391
Alignment:
| Q |
327 |
gtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| | | |||||||||||||| |||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
15042465 |
gtcccgtgagcatagctcagttggtagg-acaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
15042391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 327 - 395
Target Start/End: Original strand, 24517293 - 24517360
Alignment:
| Q |
327 |
gtcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaacccc |
395 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | ||||| | |||||| |||| |||||||||||||| |
|
|
| T |
24517293 |
gtcccgtgaacttagctcagttggtagggac-attgcatgatttatgcaggagcaggggttcgaacccc |
24517360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 26022247 - 26022318
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
26022247 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccagacac |
26022318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 26280854 - 26280783
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
26280854 |
cccgtgagcttaactcagttggtagggatat-tgcattttatatgccggagccggggttcgaaccccgaacac |
26280783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 38219626 - 38219567
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38219626 |
gctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
38219567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 42880948 - 42881019
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
42880948 |
cccgtgagcttaactcagttggtagggatat-tgcatattatatgtaggagccggggttcgaaccccggacac |
42881019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 329 - 400
Target Start/End: Original strand, 257539 - 257609
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
257539 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggggccgaggttcgaaccccggaca |
257609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 329 - 400
Target Start/End: Complemental strand, 658381 - 658311
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
658381 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggggccgaggttcgaaccccggaca |
658311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 329 - 400
Target Start/End: Complemental strand, 844117 - 844047
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggaca |
400 |
Q |
| |
|
||||||| ||| |||||||||||||||| | |||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
844117 |
cccgtgagcttagctcagttggtagggatatc-gcattttatatgcaggggccgaggttcgaaccccggaca |
844047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 401
Target Start/End: Complemental strand, 31451014 - 31450956
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
31451014 |
ctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaactccggacac |
31450956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 402
Target Start/End: Complemental strand, 17987550 - 17987475
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||| | |||||||||||||| |||||||| ||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
17987550 |
tgtcccgtgaacatagctcagttggtaggat--aatgcattattatatgcaggggccggagttcgaaccccggacacc |
17987475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 398
Target Start/End: Complemental strand, 23435300 - 23435235
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
|||| ||| ||||||||| |||||| | ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
23435300 |
gtgagcttagctcagttgatagggatat-tgcatattatatgcaggagccggggttcgaaccccgga |
23435235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 401
Target Start/End: Complemental strand, 28420492 - 28420423
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| |||||||||||||| | | ||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
28420492 |
cgtgagcttagctcagttggtaggaatat-tgcatattatatgctggagccggggttcgaaccccggacac |
28420423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 38745349 - 38745276
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcat-tttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| |||||||||||| ||| |||||||||||| ||||||| |
|
|
| T |
38745349 |
cccgtgagcttagctcagttggtagggatat-tgcatatttatatgcatgggccagggttcgaacccaggacacc |
38745276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 401
Target Start/End: Complemental strand, 43085260 - 43085222
Alignment:
| Q |
363 |
cattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
43085260 |
cattttatatgcaggggccggggttcgaaccccggacac |
43085222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 481011 - 481083
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||||| | ||||| | |||||| | |||| ||||||||||||||||||| |
|
|
| T |
481011 |
cccgtgagcttagctcagttggtagggac-attgcataatttatgcaggggccgcggttcgaaccccggacacc |
481083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 402
Target Start/End: Original strand, 7453383 - 7453424
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
7453383 |
tgcattttatatgtaggggccggggttcgaaccccggacacc |
7453424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 7765642 - 7765714
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||| ||| | | ||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
7765642 |
tcccgtgagcttagctcagttggtatggatat-tacatattatatgcaggagccggggttcgaaccccagacac |
7765714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 344 - 401
Target Start/End: Complemental strand, 8953924 - 8953868
Alignment:
| Q |
344 |
cagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||||| | ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8953924 |
cagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccggacac |
8953868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 402
Target Start/End: Original strand, 9524951 - 9525026
Alignment:
| Q |
326 |
tgtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| | | |||||||||||||| |||| |||||| ||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
9524951 |
tgtcccgtgagcatagctcagttggtagg-acaa-tgcattattatatgcaggggccggggttcgaaccccagacacc |
9525026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 13059247 - 13059175
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||||||||||||||| ||||||| | |||||| | || |||||||||||||| |||||| |
|
|
| T |
13059247 |
cccgtgagcttagctcagttggtagggac-aatgcataatttatgcaggggcaggggttcgaacccctgacacc |
13059175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 332 - 401
Target Start/End: Complemental strand, 13773459 - 13773391
Alignment:
| Q |
332 |
gtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||| | ||||||||||||| || | ||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
13773459 |
gtgaacgtagctcagttggtagagatat-tgcatattatatgtaggagccggggttcgaaccccggacac |
13773391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 394
Target Start/End: Complemental strand, 17027950 - 17027886
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccc |
394 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| |||||||| |||||||||||||||||| |
|
|
| T |
17027950 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgccggagccggggttcgaaccc |
17027886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 394
Target Start/End: Complemental strand, 17558386 - 17558322
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccc |
394 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| |||||||| |||||||||||||||||| |
|
|
| T |
17558386 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgccggagccggggttcgaaccc |
17558322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 36035249 - 36035177
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| ||||| ||||||| | |||||||||||||||||| | | ||||||||||||| |||||||| |
|
|
| T |
36035249 |
cccgtgagcttagctcaattggtaga-ataaatgcattttatatgcaggggtcggggttcgaacctcggacacc |
36035177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 402
Target Start/End: Complemental strand, 1244768 - 1244697
Alignment:
| Q |
330 |
ccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||||||| |||| ||||||| ||||| || | | ||||||||||||||||||||| |
|
|
| T |
1244768 |
ccgtgaacttagctcagttggtaaggac-aatgcataatatatacaaggtctggggttcgaaccccggacacc |
1244697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Complemental strand, 4798611 - 4798567
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4798611 |
aatgcattattatatgcaggggccggggttcgaaccccggacacc |
4798567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 5326240 - 5326169
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||| || | ||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
5326240 |
cccgtgagcttagctcagttggtagagatat-tgcattttatatgcagaggccggtgttcgaaccccggacac |
5326169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 7816415 - 7816474
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | || || ||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
7816415 |
gctcagttggtagggatat-tgaatattatatgcaggagccggggttcgaacctcggacac |
7816474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 402
Target Start/End: Original strand, 8034555 - 8034599
Alignment:
| Q |
359 |
aatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8034555 |
aatgcattattatatgcaggagccggggttcgaaccccgaacacc |
8034599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 8265268 - 8265339
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | | | ||||||||||||||||||| |
|
|
| T |
8265268 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggtcagggttcgaaccccggacac |
8265339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 402
Target Start/End: Original strand, 13105104 - 13105163
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| | ||||||||||||||| | |||||| |
|
|
| T |
13105104 |
ctcagttggtagggacaa-tgcataatatatgcaagggccggggttcgaacctcagacacc |
13105163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 327 - 402
Target Start/End: Complemental strand, 24608583 - 24608509
Alignment:
| Q |
327 |
gtcccgtgaactttgctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| | | |||||||||||||| |||| |||||| ||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
24608583 |
gtcccgtgagcatagctcagttggtagg-acaa-tgcattattatatgcaggggccggggttcgaaccccagacacc |
24608509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 26567318 - 26567247
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||| |||||| | ||||| ||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
26567318 |
cccgtgagcttagctcagttgatagggatat-tgcatattatatgcaggagtcgggattcgaaccccggacac |
26567247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 29514626 - 29514697
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | || || ||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
29514626 |
cccgtgagcttagctcagttggtagggatat-tgtatattatatgcaggagctggggttcaaaccccggacac |
29514697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 358 - 402
Target Start/End: Original strand, 34873114 - 34873158
Alignment:
| Q |
358 |
aaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||||||||||| | | ||||||||||||| |||||||| |
|
|
| T |
34873114 |
aaatgcattttatatgcaggggtcggggttcgaacctcggacacc |
34873158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 38955264 - 38955193
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| ||||||||||||||| | | ||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
38955264 |
cccgtgagcttaactcagttggtagggatat-tacatattatatgcaggggccggggttcgaaccccggacac |
38955193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 43186865 - 43186924
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||| || |||||||||||||||| |
|
|
| T |
43186865 |
gctcagttggtagggatat-tgcatattatatgcaggagccaggattcgaaccccggacac |
43186924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 402
Target Start/End: Original strand, 44444557 - 44444616
Alignment:
| Q |
342 |
ctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| | || ||||||||||||||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatat-tgcatattatatgcaggggctggggttcgaaccccggacacc |
44444616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 931 - 859
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
931 |
tcccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 59783 - 59854
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
59783 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
59854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 331 - 401
Target Start/End: Original strand, 11996 - 12065
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||| |||||||||||||||| | ||||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
11996 |
cgtgaacttagctcagttggtagggatat-tgcatattatatgcaggagccggggtttgaaccccggacac |
12065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 46526 - 46597
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | || |||||||||||||| ||||| |
|
|
| T |
46526 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggctggggttcgaaccccagacac |
46597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 402
Target Start/End: Complemental strand, 10896 - 10824
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
10896 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggggccggggttcgaaccccggacacc |
10824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 90 - 19
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
90 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccctggacac |
19 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 11178 - 11119
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11178 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
11119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 401
Target Start/End: Complemental strand, 21506 - 21447
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21506 |
gctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaccccggacac |
21447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 17620 - 17691
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
17620 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagctggggttcgaaccccggacac |
17691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 7084 - 7145
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||||||| ||||||||| |||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
7084 |
gctcagttgttagggacaa-tgcattattatatgcaggggccggggttcgaaccccggacacc |
7145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 398
Target Start/End: Original strand, 8966 - 9034
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccgga |
398 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
8966 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggagttcgaaccccgga |
9034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 4084 - 4013
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
4084 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagtcggggttcgaaccccagacac |
4013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 17331 - 17260
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||| |||||||| |||||| | ||||||||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
17331 |
cccgtgaacttaactcagttgatagggatat-tgcattttacatgcaggggccggggttcgaaccccggacac |
17260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 401
Target Start/End: Complemental strand, 266767 - 266696
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||| ||| |||||||||||||||| | ||||| ||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
266767 |
cccgtgagcttagctcagttggtagggatat-tgcatattatatgcaggagccggggttcgaaacccagacac |
266696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 401
Target Start/End: Complemental strand, 27998 - 27929
Alignment:
| Q |
331 |
cgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||| ||| |||| ||||||||||| | ||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
27998 |
cgtgagcttagctcggttggtagggatat-tgcattttatatgcaggggccggggttcgatccccggacac |
27929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 25034 - 25095
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcatt-ttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||| | || ||||||||||||||||||||| |
|
|
| T |
25034 |
gctcagttggcagggacaa-tgcattattatatgcaggggctggggttcgaaccccggacacc |
25095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 401
Target Start/End: Original strand, 3665 - 3737
Alignment:
| Q |
328 |
tcccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||| ||| ||||||||||||||| | ||||| ||||||||| || || ||||||||||||||||||| |
|
|
| T |
3665 |
tcccgtgagcttaactcagttggtagggatat-tgcatattatatgcaggaaccagggttcgaaccccggacac |
3737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 402
Target Start/End: Complemental strand, 66627 - 66586
Alignment:
| Q |
361 |
tgcattttatatgcatgagccggggttcgaaccccggacacc |
402 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
66627 |
tgcatattatatgcaggggccggggttcgaaccccggacacc |
66586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 400 - 471
Alignment:
| Q |
329 |
cccgtgaactttgctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
||||||||||| ||||| ||| |||||| | ||||| ||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
400 |
cccgtgaacttagctcaattgatagggatat-tgcatattatatgcaggggccggggttcgaacctcggacac |
471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 401
Target Start/End: Original strand, 1876 - 1935
Alignment:
| Q |
341 |
gctcagttggtagggacaaatgcattttatatgcatgagccggggttcgaaccccggacac |
401 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||| | |||| |||||||||||||||||| |
|
|
| T |
1876 |
gctcagttggtagggatat-tgcatattatatgcaggggccgaggttcgaaccccggacac |
1935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University