View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_low_12 (Length: 288)
Name: NF11462_low_12
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 43543630 - 43543429
Alignment:
| Q |
1 |
gggtagtgctaaaagacatacagtggcagataactgaagacgctttttagaagatg------cagctgccgaatgagtgatgtactgagcagtgacatct |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43543630 |
gggtagtgctaaaagacatacagtggcagataactgaagacgctttttagaagatgaagatgcagctgctgaatgagtgatgtactgagcagtgacatct |
43543531 |
T |
|
| Q |
95 |
ccaacggcccaaaggacgccggaggtggcgacttgggttctcaccggatgaacggagaggctattctgataccaattccatgccctcaatatcatcgaca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43543530 |
ccaacggcccaaaggacgccggaggtggcgacttgggttctcaccggatgaacggagaggctattctgataccaattccatgccctcaatatcatcgaca |
43543431 |
T |
|
| Q |
195 |
tg |
196 |
Q |
| |
|
|| |
|
|
| T |
43543430 |
tg |
43543429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University