View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11462_low_13 (Length: 270)

Name: NF11462_low_13
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11462_low_13
NF11462_low_13
[»] chr3 (1 HSPs)
chr3 (1-260)||(51061486-51061741)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 51061741 - 51061486
Alignment:
1 aagttgtcccaaaaactataacaaaatataacgatataaatatcatttttctaaatgnnnnnnnnnnnnnatggagcaaattctaacttctctaattaca 100  Q
    ||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||              ||||||||||||||||||||||||||||||    
51061741 aagttgtcccaaaaattataacaaaatataacaatataaatatcatttttttaaatctttttatttttttatggagcaaattctaacttctctaattaca 51061642  T
101 ttgtttaaaggatgaaatcaataaatttaatgattttatcatttagtttagtttgaccggagaaagggaaacaaagaaaggatgatcaaataacccatgg 200  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
51061641 ttgttttaaggatgaaatcaataaatttaatgattttatcatttagtttagtttgaccggagaaagggaaacaaagaaaggatgatcaaataacccat-- 51061544  T
201 atggatatagcaaagaaatctgattttacgaattttcattatctgtcacgtcattttcat 260  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51061543 --ggatatagcaaagaaatctgattttacgaattttcattatctgtcacgtcattttcat 51061486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University