View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_low_13 (Length: 270)
Name: NF11462_low_13
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 51061741 - 51061486
Alignment:
| Q |
1 |
aagttgtcccaaaaactataacaaaatataacgatataaatatcatttttctaaatgnnnnnnnnnnnnnatggagcaaattctaacttctctaattaca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51061741 |
aagttgtcccaaaaattataacaaaatataacaatataaatatcatttttttaaatctttttatttttttatggagcaaattctaacttctctaattaca |
51061642 |
T |
|
| Q |
101 |
ttgtttaaaggatgaaatcaataaatttaatgattttatcatttagtttagtttgaccggagaaagggaaacaaagaaaggatgatcaaataacccatgg |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51061641 |
ttgttttaaggatgaaatcaataaatttaatgattttatcatttagtttagtttgaccggagaaagggaaacaaagaaaggatgatcaaataacccat-- |
51061544 |
T |
|
| Q |
201 |
atggatatagcaaagaaatctgattttacgaattttcattatctgtcacgtcattttcat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51061543 |
--ggatatagcaaagaaatctgattttacgaattttcattatctgtcacgtcattttcat |
51061486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University