View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_low_15 (Length: 255)
Name: NF11462_low_15
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 12804327 - 12804560
Alignment:
| Q |
12 |
ctcttcttgatgttgatgcacttgatgttatatatttctatgtgataccttttttaattgcttagagtggcagcaagtctttannnnnnnnnnaatggaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12804327 |
ctcttcttgatgttgatgcacttgatgttatatatttctatgtgataccttttttaattgcttagagtggcagcaagtctttatttttttt--aatggaa |
12804424 |
T |
|
| Q |
112 |
gagtgtgaagatgtgaaaatgaggtgtcagtgtggatataaattgtaaagtnnnnnnntttgaagaataaataatagaaaagaagaaatagaagcaatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12804425 |
gagtgtgaagatgtgaaaatgaggtgtcggtgtggatataaattgtaaagtaaaaaaatttgaagaataaataatagaaaagaagaaatagaagcaatta |
12804524 |
T |
|
| Q |
212 |
tttctttttagggctttgcttttaactatatgatct |
247 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
12804525 |
tttctttttagggctttgcttctaactctatgatct |
12804560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 181 - 247
Target Start/End: Complemental strand, 23344908 - 23344842
Alignment:
| Q |
181 |
aataatagaaaagaagaaatagaagcaattatttctttttagggctttgcttttaactatatgatct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||| |||||||| |
|
|
| T |
23344908 |
aataatagaaaagaagaaatagaagcaattatttcttttttggggtttgcttgtaactctatgatct |
23344842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University