View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_low_16 (Length: 243)
Name: NF11462_low_16
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 226
Target Start/End: Original strand, 51061794 - 51062000
Alignment:
| Q |
20 |
atcaatacctacatttcaaataacataacatacctcaaaaatttaatcaggattagaaatgatcggaaagaaccttttgcatacatttctttttagggta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51061794 |
atcaatacctacatttcaaataacataacatacctcaaaaatttaatcaggattagaaataatcggaaagaaccttttgcatacatttctttttagggta |
51061893 |
T |
 |
| Q |
120 |
taacttgcccggttattaatttcttctaagtgaatgtatggatttataataatcttctggttagcaagtaataccatgagtataaaaagactgcagagat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51061894 |
taacttgcccggttattaatttcttctaagtgaatgtatggatttataataatcttctggttagcaagtaataccatgagtataaaaagactgcagagat |
51061993 |
T |
 |
| Q |
220 |
atcatgg |
226 |
Q |
| |
|
||||||| |
|
|
| T |
51061994 |
atcatgg |
51062000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University