View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11462_low_16 (Length: 243)

Name: NF11462_low_16
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11462_low_16
NF11462_low_16
[»] chr3 (1 HSPs)
chr3 (20-226)||(51061794-51062000)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 226
Target Start/End: Original strand, 51061794 - 51062000
Alignment:
20 atcaatacctacatttcaaataacataacatacctcaaaaatttaatcaggattagaaatgatcggaaagaaccttttgcatacatttctttttagggta 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
51061794 atcaatacctacatttcaaataacataacatacctcaaaaatttaatcaggattagaaataatcggaaagaaccttttgcatacatttctttttagggta 51061893  T
120 taacttgcccggttattaatttcttctaagtgaatgtatggatttataataatcttctggttagcaagtaataccatgagtataaaaagactgcagagat 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51061894 taacttgcccggttattaatttcttctaagtgaatgtatggatttataataatcttctggttagcaagtaataccatgagtataaaaagactgcagagat 51061993  T
220 atcatgg 226  Q
    |||||||    
51061994 atcatgg 51062000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University