View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_low_17 (Length: 238)
Name: NF11462_low_17
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 39441341 - 39441133
Alignment:
| Q |
15 |
cagagaggattgaaaat-agtgtaaacggggctcatattattggcaataggtgtcagccacacaacatgagtttttagaatgaattttgaagctgaaatt |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39441341 |
cagagaggattgaaaattagtgtaaacggggctcatattattggcaataggtgtcagccacacaacatgagtttttagaatgaattttgaagctgaaatt |
39441242 |
T |
 |
| Q |
114 |
tacaaaacttgactcagaagccaatgcgtaaagaaccaattgatactgtcctaaccaattgttactagtaatttctcctaacctatatccacagcaaaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39441241 |
tacaaaacttgactcagaagccaatgcgtaaagaaccaattgatactgtcctaaccaattgttactagtaatttctcctaacctatatccacagcaaaca |
39441142 |
T |
 |
| Q |
214 |
ttatgaact |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
39441141 |
ttatgaact |
39441133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University