View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_low_4 (Length: 428)
Name: NF11462_low_4
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 3e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 50 - 268
Target Start/End: Complemental strand, 49095731 - 49095511
Alignment:
| Q |
50 |
aaaacatgtcaatcgaaagcgatctttgaaccccttagttgggtcaattttgacatacgaaagagaagacgaaactttgcttcccaccccatatgtttta |
149 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49095731 |
aaaacatgtca-tcgaaagcgatctttgaaccccttagttgggtcaattttgacatacgaaagagaagacgaaactttgcttcccaccccatatgtttta |
49095633 |
T |
 |
| Q |
150 |
aaccactcaccccacc---nnnnnnnnnnngactaattgctcctctttggaagtatacttatggatggctcgtttaaaactctcttcatccacaatttaa |
246 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49095632 |
aaccactcaccccacctttttattttttttgactaattgctcctctttggaagtatacttatggatggctcgtttaaaactctcttcatccacaatttaa |
49095533 |
T |
 |
| Q |
247 |
aataaaagaaaagtatctacaa |
268 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49095532 |
aataaaagaaaagtatctacaa |
49095511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University