View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11462_low_7 (Length: 350)
Name: NF11462_low_7
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11462_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 14 - 334
Target Start/End: Complemental strand, 3225607 - 3225287
Alignment:
| Q |
14 |
agaagaaaacaacacaagaagggaaatgaggcaaaaaggtaaaaaacatgatggaccatgtgaagcaaccaacccaattgatagttgttggaggtgcaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225607 |
agaagaaaacaacacaagaagggaaatgaggcaaaaaggtaaaaaacatgatggaccatgtgaagcaaccaacccaattgatagttgttggaggtgcaaa |
3225508 |
T |
 |
| Q |
114 |
gccgattgggctgcgaatcgatttcaattagccaagtgtagtaagggctttggaagaaaggcaactggtgggcttggaggtccaatctatgtggtcactg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225507 |
gccgattgggctgcgaatcgatttcaattagccaagtgtagtaagggctttggaagaaagacaactggtgggcttggaggtccaatctatgtggtcactg |
3225408 |
T |
 |
| Q |
214 |
atgagtctgataatgacatggtaaaccctaaacctggaacccttagatttggtgttgtccaaaagggaccattatggatcacttttgcacgtagcatggt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225407 |
atgagtctgataatgacatggtaaaccctaaacctggaacccttagatttggtgctgtccaaaagggaccattatggatcacttttgcacgtagcatggt |
3225308 |
T |
 |
| Q |
314 |
cattagattgaaccaagaatt |
334 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3225307 |
cattagattgaaccaagaatt |
3225287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University