View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11463_high_4 (Length: 251)
Name: NF11463_high_4
Description: NF11463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11463_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 1542799 - 1542557
Alignment:
| Q |
1 |
tgttgtgtatggt-gttcgtatatgtgtctgcgcttcatatatcaataaaaccctatgcagcaccaacatgaagatgacaaaacacagtgacaagtcaat |
99 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1542799 |
tgttgtgtatggttgttcgtatatgtgtctgtgcttcatatatcaataaaaccctatgcagcaccaacatgaacatgacaaaacacagtgacaagtcaat |
1542700 |
T |
|
| Q |
100 |
cccggtaaacatgtaaacatgtcaatgttatagagataaaacccacatagacaaaagaataaatcatgcatttatatattatgatgattactttccgata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1542699 |
cccggtaaacatgtaaacatgtcaatgttatagagataaaacccacatagacaaaagaataaatcatgcatttatatattatgatgattactttccgata |
1542600 |
T |
|
| Q |
200 |
acctccgcgaatgttttgatataaccatcgataatttcatctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1542599 |
acctccgcgaatgttttgatataaccatcgataatttcatctc |
1542557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 173 - 242
Target Start/End: Complemental strand, 32424516 - 32424447
Alignment:
| Q |
173 |
atatattatgatgattactttccgataacctccgcgaatgttttgatataaccatcgataatttcatctc |
242 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32424516 |
atatattatggttattactttccgataacctccacgaatgttttgatataaccatcgataatttcatctc |
32424447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University