View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11464_high_28 (Length: 216)

Name: NF11464_high_28
Description: NF11464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11464_high_28
NF11464_high_28
[»] chr4 (1 HSPs)
chr4 (126-200)||(3187799-3187873)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 126 - 200
Target Start/End: Original strand, 3187799 - 3187873
Alignment:
126 gtgattgtgacatgtgatcttaagaaattatcaatgattgatacttaatcatgcacctagttggggacttaacaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3187799 gtgattgtgacatgtgatcttaagaaattatcaatgattgatacttaatcatgcacctagttggggacttaacaa 3187873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University