View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11464_low_26 (Length: 237)
Name: NF11464_low_26
Description: NF11464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11464_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 31265438 - 31265213
Alignment:
| Q |
1 |
tcttttgatttgatctgggaataattcgtgcagggacatattggggaattcagaagatgcgtgtgattatagacgggtttaagatttttattctgcaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31265438 |
tcttttgatttgatctgggaataattcgtgtggggacatattggggaattcagaagatgcgtgtgattatagacgggtttaagatttttattctgcaatt |
31265339 |
T |
 |
| Q |
101 |
atgttaagctgctcattgttatttgttttcactgtttttgttacagcaaccatgaaccctctgatgatgaagatgaagtgagtaaaacacttaacctttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31265338 |
atgttaagctgctcattgttatttgttttcactgtttttgttacagccaccatgaaccctctgatgatgaagatgaagtgagtaaaacacttaccctttt |
31265239 |
T |
 |
| Q |
201 |
cattagctattagtggaactcattga |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31265238 |
cattagctattagtggaactcattga |
31265213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University