View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11464_low_27 (Length: 217)

Name: NF11464_low_27
Description: NF11464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11464_low_27
NF11464_low_27
[»] chr3 (1 HSPs)
chr3 (24-203)||(52850613-52850792)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 24 - 203
Target Start/End: Complemental strand, 52850792 - 52850613
Alignment:
24 acttgcttactgagcattttcctctcacgggttagagacagcaggctgttcagtaattgtggcatgaaaatagtgtgaaaacttgatatatgacataaaa 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52850792 acttgcttactgagcattttcctctcacgggttagagacagcaggctgttcagtaattgtggcatgaaaatagtgtgaaaacttgatatatgacataaaa 52850693  T
124 atagcatataattgtgactttatgcaagtgtttgatgtaaagtattcaaagtgaaacaccagccattatgtttcatctca 203  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
52850692 atagcatataattgtgactttatgcaagtgtttgatgtaaagcattcaaagtgaaacaccagccattatgtttcatctca 52850613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University