View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11464_low_27 (Length: 217)
Name: NF11464_low_27
Description: NF11464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11464_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 24 - 203
Target Start/End: Complemental strand, 52850792 - 52850613
Alignment:
| Q |
24 |
acttgcttactgagcattttcctctcacgggttagagacagcaggctgttcagtaattgtggcatgaaaatagtgtgaaaacttgatatatgacataaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850792 |
acttgcttactgagcattttcctctcacgggttagagacagcaggctgttcagtaattgtggcatgaaaatagtgtgaaaacttgatatatgacataaaa |
52850693 |
T |
 |
| Q |
124 |
atagcatataattgtgactttatgcaagtgtttgatgtaaagtattcaaagtgaaacaccagccattatgtttcatctca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850692 |
atagcatataattgtgactttatgcaagtgtttgatgtaaagcattcaaagtgaaacaccagccattatgtttcatctca |
52850613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University