View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11464_low_29 (Length: 212)
Name: NF11464_low_29
Description: NF11464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11464_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 24476380 - 24476194
Alignment:
| Q |
13 |
agagatgaagtgaaatctagagagagaaacgaatgagggggttgaatcaaatgaagttgaggctgtgtttgtgtcttcgtacacgtcggtatgtaatgtc |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24476380 |
agagaagaagtgaaatctagagagagaaacgaatgatggggttgaatcaaatgaagttgaggctgtgtttgtgtctgcgtacgcgtcggtatgtaatgtc |
24476281 |
T |
 |
| Q |
113 |
aagttgaaagaatgagaagagtttgctgctgctagtgctatgctactggtttctcttctttctatcgatctatataactttcctttt |
199 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24476280 |
aagttaaaagagtgagaagattttgctgctgctagtgctatgctactggtttctcttctttctatcgatctatataactttcctttt |
24476194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 185
Target Start/End: Complemental strand, 17684180 - 17684131
Alignment:
| Q |
136 |
tgctgctgctagtgctatgctactggtttctcttctttctatcgatctat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| |||||||||| |
|
|
| T |
17684180 |
tgctgctgctagtgctatgctactggttcctcctctttcgatcgatctat |
17684131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University