View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11464_low_29 (Length: 212)

Name: NF11464_low_29
Description: NF11464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11464_low_29
NF11464_low_29
[»] chr2 (1 HSPs)
chr2 (13-199)||(24476194-24476380)
[»] chr4 (1 HSPs)
chr4 (136-185)||(17684131-17684180)


Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 24476380 - 24476194
Alignment:
13 agagatgaagtgaaatctagagagagaaacgaatgagggggttgaatcaaatgaagttgaggctgtgtttgtgtcttcgtacacgtcggtatgtaatgtc 112  Q
    ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||    
24476380 agagaagaagtgaaatctagagagagaaacgaatgatggggttgaatcaaatgaagttgaggctgtgtttgtgtctgcgtacgcgtcggtatgtaatgtc 24476281  T
113 aagttgaaagaatgagaagagtttgctgctgctagtgctatgctactggtttctcttctttctatcgatctatataactttcctttt 199  Q
    ||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24476280 aagttaaaagagtgagaagattttgctgctgctagtgctatgctactggtttctcttctttctatcgatctatataactttcctttt 24476194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 185
Target Start/End: Complemental strand, 17684180 - 17684131
Alignment:
136 tgctgctgctagtgctatgctactggtttctcttctttctatcgatctat 185  Q
    |||||||||||||||||||||||||||| ||| |||||| ||||||||||    
17684180 tgctgctgctagtgctatgctactggttcctcctctttcgatcgatctat 17684131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University