View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11465_high_16 (Length: 256)
Name: NF11465_high_16
Description: NF11465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11465_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 24931355 - 24931538
Alignment:
| Q |
1 |
actaggataaaaatgaagttacggaccttgatttaaccttgtggagaaaactcggttgacaaggtagaactaacattttgtgttcaacatgtttttcaat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||| ||| |||| |||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
24931355 |
actaggataaaaatgaagttacggaacttgatttaaccttatggagaaaattcgattgagaagggagaactaacattttgtgttcaatatgtttttcaat |
24931454 |
T |
 |
| Q |
101 |
agagaccattcattgttaaactacgacgaatatttcatacctataacatggttagatnnnnnnntaacaagattttggattcaa |
184 |
Q |
| |
|
|||| | |||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24931455 |
agagtcaattcatcgttaaactacggcgaatatttcatacctataacatggttagattaaaaaataacaagattttggattcaa |
24931538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 198 - 231
Target Start/End: Original strand, 24931534 - 24931567
Alignment:
| Q |
198 |
ttcaatcaatttctctcaaatgcatctctatccc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24931534 |
ttcaatcaatttctctcaaatgcatctctatccc |
24931567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University