View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11465_high_20 (Length: 247)
Name: NF11465_high_20
Description: NF11465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11465_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 34674811 - 34675024
Alignment:
| Q |
18 |
ggcagtgcaagtaagtgtgtgtggatgaaaaagcttacactcgaaggggagtatagtgaatggaaatcactcgtacttgagagcatagattgttgtggca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34674811 |
ggcagtgcaagtaagtgtgtgtggatgaaaaagcttacacttgaaggggagtatagtgaatggaaatcactcgtacttgagagtggagattgttgtggca |
34674910 |
T |
 |
| Q |
118 |
agtgtgaggtgagtaagaattcacatatttcttaaaaaagtagaggttgaacaatttacaagtgaaatgtccataaatctattatcttaaaatttcggat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34674911 |
agtgtgaggtgagtaagaattcacatatttcttaaaaaagtagaggttgaacaatttacaagtgaaatgtccataaatctattatcttaaaattttggat |
34675010 |
T |
 |
| Q |
218 |
caagatgtgatgtc |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34675011 |
caagatgtgatgtc |
34675024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University