View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11465_high_23 (Length: 204)
Name: NF11465_high_23
Description: NF11465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11465_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 22 - 190
Target Start/End: Original strand, 54619882 - 54620050
Alignment:
| Q |
22 |
ggaccatcataaagtagccaattggggacagaataagagggtgttgattgagacagtgatagctaagccacagaatgatgaatacatagctctaagtatg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54619882 |
ggaccatcataaagtagccaattggggacagaataagagggtgttgattgagacagtgatagctaagccacagaatgatgaatacatagctctaagtatg |
54619981 |
T |
|
| Q |
122 |
cggtgtaaaggagtgttatgggcagacatttctttgtctccaatttattagaatcatattttgtctctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54619982 |
cggtgtaaaggagtgttatgggcagacatttctttgtctccaatttattagaatcatattttgtctctg |
54620050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University