View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11465_low_12 (Length: 309)
Name: NF11465_low_12
Description: NF11465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11465_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 55477544 - 55477250
Alignment:
| Q |
1 |
acacaaagacactcaccattactatcatcaacttcaagaagaaaatgcaacaatgaatgcagttcaccagaatttgaattctggatgctaagaaacccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
55477544 |
acacaaagacactcaccattactatcatcaacttcaagaagaaaatgcaacaatgaatgcagttcaccagaatttgaattctggatgctaagaaaccctt |
55477445 |
T |
 |
| Q |
101 |
ctttcccacaacccaacatcattcccgccgatcaactcttccttaacggcgtcatccttccccttcacctcctttccacccaaaacaaacacgaccctgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
55477444 |
ctttcccacaacccaacatcattcccgccgatcaactcttccttaacggcgtcatccttccccttcatctcctttccacccaaaacaaacacgaccctgt |
55477345 |
T |
 |
| Q |
201 |
tcaagaacccaactcatcccctgccataaccgatggtttaaccatcactaccaccacaacatccaagcgatggaaaaacatcttcatgaagaaaa |
295 |
Q |
| |
|
|| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55477344 |
tccagaacccaactcatcccctcccataaccgatggtttaaccatcactaccaccacaacatccaagcgatggaaaaacatcttcatgaagaaaa |
55477250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University