View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11465_low_13 (Length: 308)
Name: NF11465_low_13
Description: NF11465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11465_low_13 |
 | |
|
| [»] scaffold0400 (1 HSPs) |
| | |
|
| [»] scaffold0365 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0400 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 2266 - 2549
Alignment:
| Q |
1 |
agttggttttgccaccggttttcgctaaatgtaccaaggttttggatgcaagggatcaaatagttgcaagagatttgtattgggaagctttaaattgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| | | |||||| |
|
|
| T |
2266 |
agttggttttgccaccggttttcgctaaatgtaccaaggttttggatgcaagggatcaaattgttgcaagggatttgtattgggaagctatgatttgtga |
2365 |
T |
|
| Q |
101 |
agaagggttggataagattgaggagatgttggtgaagagtattgagaaaaacccttttgtaggagagccatatgtggtgttgagtcaagtttatttgaca |
200 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2366 |
agaagggttggagaagattgaggagttgttggtgaagagtattgagaaaaacccttttgtgggagagccatatgtggtgttgagtcaagtttatttgaca |
2465 |
T |
|
| Q |
201 |
aagggtagatttgaagatgctgagaaagaagctgagagaggattgactcttttgcttgaatggggatgtcattgggataaaagg |
284 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466 |
aagggtagatttgaagagggtgagaaagaagctgagagaggattgactcttttgcttgaatggggatgtcattgggataaaagg |
2549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 2910 - 3193
Alignment:
| Q |
1 |
agttggttttgccaccggttttcgctaaatgtaccaaggttttggatgcaagggatcaaatagttgcaagagatttgtattgggaagctttaaattgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| | | |||||| |
|
|
| T |
2910 |
agttggttttgccaccggttttcgctaaatgtaccaaggttttggatgcaagggatcaaattgttgcaagggatttgtattgggaagctatgatttgtga |
3009 |
T |
|
| Q |
101 |
agaagggttggataagattgaggagatgttggtgaagagtattgagaaaaacccttttgtaggagagccatatgtggtgttgagtcaagtttatttgaca |
200 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3010 |
agaagggttggagaagattgaggagttgttggtgaagagtattgagaaaaacccttttgtgggagagccatatgtggtgttgagtcaagtttatttgaca |
3109 |
T |
|
| Q |
201 |
aagggtagatttgaagatgctgagaaagaagctgagagaggattgactcttttgcttgaatggggatgtcattgggataaaagg |
284 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3110 |
aagggtagatttgaagagggtgagaaagaagctgagagaggattgactcttttgcttgaatggggatgtcattgggataaaagg |
3193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University