View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11465_low_15 (Length: 273)
Name: NF11465_low_15
Description: NF11465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11465_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 14845916 - 14845805
Alignment:
| Q |
1 |
ttacagtgtgtattgtttcaagaaagagtttggatttggctgcgagattgacgatcaaaccaagaataacctcacaggtttttgctccttaaacaatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14845916 |
ttacagtgtgtattgtttcaagaaagagtttggatttggctgcgagattgacgagcaaaccaagaataacctcggaggtttttgctccttaaacaatgtt |
14845817 |
T |
 |
| Q |
101 |
gcatttcaaaga |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14845816 |
gcatttcaaaga |
14845805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 177 - 259
Target Start/End: Complemental strand, 14845741 - 14845659
Alignment:
| Q |
177 |
accagtgatgcctggagttatgtttatacttcctgatgtatacatggatattcagaagaaagactatggtggtgaggattttg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14845741 |
accagtgatgcctggagttatgtttatacttcctgatgtatacatggatattcagaagaaatactatggtggtgaggattttg |
14845659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University