View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11466_high_8 (Length: 567)
Name: NF11466_high_8
Description: NF11466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11466_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 550; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 550; E-Value: 0
Query Start/End: Original strand, 1 - 554
Target Start/End: Original strand, 37501088 - 37501641
Alignment:
| Q |
1 |
atgctgctcatgtaagcatttcagtggactccggcgtagccattgccaaagacatggcagacataatcttactagagaaagatctaaacgtgctcgttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37501088 |
atgctgctcatgtaagcatttcagtggactccggcgtagccattgccaaagacatggcagacataatcttactagagaaagatctaaacgtgctcgttgc |
37501187 |
T |
 |
| Q |
101 |
gggcgtggagcacggtcgtctcacctttggcaacacaatgaagtacttaaagatgtcggttattgctaacttgggaagtatcatttcactcctcatagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37501188 |
gggcgtggagcacggtcgtctcacctttggcaacacaatgaagtacttaaagatgtcggttattgctaacttgggaagtatcatttcactcctcatagca |
37501287 |
T |
 |
| Q |
201 |
acattgttcctaaaatatgagcccttgacttctagacagctacttacacagaatttcatctatagccttggacgaatcgtcatcccttgggacaaaatgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37501288 |
acattgttcctaaaatatgagcccttgacttctagacagctacttacacagaatttcatctatagccttggacaaatcgtcatcccttgggacaaaatgg |
37501387 |
T |
 |
| Q |
301 |
atgaagaatatttgaacactcctcataagtggtccgtgcgaggcttgccgatgttcatattgtggaatggaccggtatgcattttatgtgacgtggcaac |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37501388 |
atgaagaatatttgaacactcctcataagtggtccgtgcgaggcttgccgatgttcatattgtggaatggaccggtatgcattttatgtgacgtggcaac |
37501487 |
T |
 |
| Q |
401 |
acttttgtttctttggttttattgcaaggcttatgatgatatgaaattttttcattcagcttggttcattgagggtcttctgatgcaaactctgattgtt |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37501488 |
acttttgtttctttggttttattgcaaggcttatgatgatatgaaattttttcattcagcttggttcattgagggtcttctgatgcaaactctgattgtt |
37501587 |
T |
 |
| Q |
501 |
catttgatgaggactgagaaaatccctttcattcaggatattgcttcttggcct |
554 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37501588 |
catttgatgaggactgagaaaatccctttcattcaggatattgcttcttggcct |
37501641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University