View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11466_low_18 (Length: 364)
Name: NF11466_low_18
Description: NF11466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11466_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 25730637 - 25730721
Alignment:
| Q |
18 |
caagttgaatccttaaagagttttgagatgatagttatgtatccaccaatcttagtttgtgacgcaagaaacgtttgatcgagtg |
102 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25730637 |
caagttaaatccttaaaaagttttgagatgatagttatgtatccacaaatcttagtttgtgacgcaagaaacgtttgatcgagtg |
25730721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 175 - 223
Target Start/End: Original strand, 25730794 - 25730842
Alignment:
| Q |
175 |
ggtgacttacctacaccattcgttcaacaattttatcttgtgagaatag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25730794 |
ggtgacttacctacaccattcgttcaacaattttatcttgtgagtatag |
25730842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University