View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11466_low_24 (Length: 309)
Name: NF11466_low_24
Description: NF11466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11466_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 36574896 - 36574595
Alignment:
| Q |
1 |
cgatcacacattttattagttaaaaaattgtttctaaatatcctaaatatttgcaggttggagagccgaacatggatcacaggtgttgggaaaggccgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574896 |
cgatcacacattttattagttaaaaaattgtttctaaatatcctaaatatttgcaggttggagagccgaacatggatcacaggtgttgggaaaggccgga |
36574797 |
T |
 |
| Q |
101 |
ggacatggacactccacgcaatgtgtataaggtctcggctcaaaatccaggttctgatgtcgcggctgagacggctgctgcattggcagcgtcttcatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574796 |
ggacatggacactccacgcaatgtgtataaggtctcggctcaaaatccaggttctgatgtcgcggctgagacggctgctgcattggcagcgtcttcatta |
36574697 |
T |
 |
| Q |
201 |
gtattcagagatacagatccatcatattcctccaaattgcttcaagcagccatccaagtatgttcctcttctaaaacacaatttttcctagttttcatct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574696 |
gtattcagagatacagatccatcatattcctccaaattgcttcaagcagccatccaagtatgttcctcttctaaaacacaatttttcctagttttcatct |
36574597 |
T |
 |
| Q |
301 |
ct |
302 |
Q |
| |
|
|| |
|
|
| T |
36574596 |
ct |
36574595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University