View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11466_low_35 (Length: 233)
Name: NF11466_low_35
Description: NF11466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11466_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 6432530 - 6432728
Alignment:
| Q |
16 |
aaaggggtaagagcttggacagattatgacattcatattggaaatacaacgacaaacaaggttgaatttgctcatagttagttaaaaaagaatctagcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6432530 |
aaaggggtaagagcttggacagattatgacattcatattggaaatacaacgacaaacaaggttgaatttgctcatagttagttaaaaaagaatctagcag |
6432629 |
T |
 |
| Q |
116 |
ataatatggtgatatatgtaaaaattgggtttcaaataacacgatagcacacttagatacaagtctagtttgaaaagagcatgatttcaatggaacaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6432630 |
ataatatggtgatatatgtaaaaattgggtttcaaataacacgatagcacacttagatacaagtctagtttgaaaagaacatgatttcaatggaacaca |
6432728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University