View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11466_low_38 (Length: 201)
Name: NF11466_low_38
Description: NF11466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11466_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 39483172 - 39483357
Alignment:
| Q |
1 |
aatccctccgagtgtttcactgtcggtaaatttgtgtcctgggcctccggaacttggacccgaatccttgatccctccgagtgtttcaattggcacacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39483172 |
aatccctccgagtgtttcactgtcggtaaatttgtgtcctgggcctccggaacttggacccgaatccttgatccctccgagtgtttcaattggcacacct |
39483271 |
T |
|
| Q |
101 |
tgcttgattgctccaagagaatgtgataaccaatcaaacaaatccacgacttcctctctagtagctgagtttttggtgtcaatgat |
186 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39483272 |
tgtttgattgctccaagagaatgtgataaccaatcgaacaaatccaagacttcctctctagtagctgagtttttggtgtcaatgat |
39483357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 17 - 88
Target Start/End: Original strand, 39483119 - 39483190
Alignment:
| Q |
17 |
tcactgtcggtaaatttgtgtcctgggcctccggaacttggacccgaatccttgatccctccgagtgtttca |
88 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39483119 |
tcactgttggtaaatttgtgtcccacgcctccggaacttggacccgaatccttaatccctccgagtgtttca |
39483190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University