View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11466_low_38 (Length: 201)

Name: NF11466_low_38
Description: NF11466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11466_low_38
NF11466_low_38
[»] chr4 (2 HSPs)
chr4 (1-186)||(39483172-39483357)
chr4 (17-88)||(39483119-39483190)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 39483172 - 39483357
Alignment:
1 aatccctccgagtgtttcactgtcggtaaatttgtgtcctgggcctccggaacttggacccgaatccttgatccctccgagtgtttcaattggcacacct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39483172 aatccctccgagtgtttcactgtcggtaaatttgtgtcctgggcctccggaacttggacccgaatccttgatccctccgagtgtttcaattggcacacct 39483271  T
101 tgcttgattgctccaagagaatgtgataaccaatcaaacaaatccacgacttcctctctagtagctgagtttttggtgtcaatgat 186  Q
    || |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||    
39483272 tgtttgattgctccaagagaatgtgataaccaatcgaacaaatccaagacttcctctctagtagctgagtttttggtgtcaatgat 39483357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 17 - 88
Target Start/End: Original strand, 39483119 - 39483190
Alignment:
17 tcactgtcggtaaatttgtgtcctgggcctccggaacttggacccgaatccttgatccctccgagtgtttca 88  Q
    ||||||| |||||||||||||||   ||||||||||||||||||||||||||| ||||||||||||||||||    
39483119 tcactgttggtaaatttgtgtcccacgcctccggaacttggacccgaatccttaatccctccgagtgtttca 39483190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University