View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11467_high_24 (Length: 240)
Name: NF11467_high_24
Description: NF11467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11467_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 52088227 - 52088412
Alignment:
| Q |
20 |
attaccacctcctacacaaccgatgttagttcatgtactaactaactgatgactagatctcataatagtgtatttggaaaactttgtgtgtatatgattt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
52088227 |
attaccacctcctacacaaccgatgttagttcatgtagtaact----gatgactagatctcataatggtgtatttggaaaactttgtgtgtgtatgattt |
52088322 |
T |
|
| Q |
120 |
atatcatattactnnnnnnnnnnnnnnnnn---taatattgttatttgtattgctatcactcaaaccgggtgctttgtgtctgtttgtcc |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
52088323 |
atatcatattactattatcatcatcatcatcattaatattgttatttgtattgctatcactaaaacggggtgttttgtgtctgtttgtcc |
52088412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University