View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11467_high_25 (Length: 239)
Name: NF11467_high_25
Description: NF11467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11467_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 49432898 - 49433120
Alignment:
| Q |
1 |
attgatctgggcttaggttgtgacatagctttctcttgttcagtaagtgcatgacggaaatggcatctatggccataagggcacacaaccccagcaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49432898 |
attgatctgggcttaggttgtgacatagctttctcttgttcagtaagtgcatgacggaaatggcatctatggccataagggcacacaaccccagcaagga |
49432997 |
T |
|
| Q |
101 |
ccatcctgcagacctcagttttgtagcgtgggtggcggatcactgggcgaagctccccaatgccatgagcgaattgacagtggtctccataagggcatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49432998 |
ccatcctgcagacctcagttttgtagcgtgggtggcggatcactgggcgaagctccccaatgccatgagcgaattgacagtggtctccataagggcatgt |
49433097 |
T |
|
| Q |
201 |
gccagtttcctgccatttgttac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49433098 |
gccagtttcctgccatttgttac |
49433120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 23 - 206
Target Start/End: Original strand, 39170714 - 39170897
Alignment:
| Q |
23 |
acatagctttctcttgttcagtaagtgcatgacggaaatggcatctatggccataagggcacacaaccccagcaaggaccatcctgcagacctcagtttt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39170714 |
acatagctttctcttgttcagtaagtgcatgacggaaatggcatctatggccacacgggcacacaaccccagcaaggaccatcctgcagacctcagtttt |
39170813 |
T |
|
| Q |
123 |
gtagcgtgggtggcggatcactgggcgaagctccccaatgccatgagcgaattgacagtggtctccataagggcatgtgccagt |
206 |
Q |
| |
|
||||||||| |||||||||| | |||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39170814 |
gtagcgtggatggcggatcatttggcgaagctctccaatgccgtgagcaaattgacagtggtctccataagggcatgtgccagt |
39170897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University