View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11467_low_15 (Length: 299)
Name: NF11467_low_15
Description: NF11467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11467_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 26 - 277
Target Start/End: Complemental strand, 13280395 - 13280145
Alignment:
| Q |
26 |
caattcttaattggaattgaagcaaacaacatgtagaaggggtgtttatggaaagatgttaaacattcaagggctatcaacatgcttgatgagattgagc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13280395 |
caattcttaattggaattgaagcaaacaacatgtagaaggggtgtc-atggaaagatgttaaacattcaagggctatcaacatgcttgatgagattgagc |
13280297 |
T |
|
| Q |
126 |
aaggaatgttgagtcgatcagcttagagaggcggatgcattaacattcattgatcggtctagagacgaaatggcaagaaaactcaaggttaaatggagag |
225 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13280296 |
aaggaatgttgagttgatcagcttaaagaggcggatgcattaacattcattgatcggtctagagacgaaatggcaagaaaactcaaggttaaatggagag |
13280197 |
T |
|
| Q |
226 |
gcgcatgcggtggcggattttgagttattttgttgggtatcaaacttttatg |
277 |
Q |
| |
|
||| |||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13280196 |
gcgtatgcagtggcggattttgagttattttgttgggtaccaaacttttatg |
13280145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University