View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11467_low_22 (Length: 269)
Name: NF11467_low_22
Description: NF11467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11467_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 3 - 255
Target Start/End: Complemental strand, 32789323 - 32789071
Alignment:
| Q |
3 |
gaagagtacagtgattgtgccaaaagttggaggacaatatggtaatattacaagcgaccaatcaccaagagttgagctatactctgaaagaaggggtgaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789323 |
gaagagtacagtgattgtgccaaaagttggaggacaatatggtaatattacaagcgaccaatcaccaagagttgagctatactctgaaagaaggggtgaa |
32789224 |
T |
 |
| Q |
103 |
gatttagatagttcaaactatttgatgcaaatgaaggattgttcacctcacaatatggtaaatgagacttctctcaatatcaatggtacatcaagggatc |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789223 |
gatttagatagttcaaattatttgatgcaaatgaaggattgttcaccacacaatatggtaaatgagacttctctcaatatcaatggtacatcaagggatc |
32789124 |
T |
 |
| Q |
203 |
atggaaattggtcgcaattctcatctcaagacccattatttagtcttccaact |
255 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789123 |
atggaaattggttgcaattctcatctcaagacccattatttagtcttccaact |
32789071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University