View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11468_high_6 (Length: 389)
Name: NF11468_high_6
Description: NF11468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11468_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 16 - 174
Target Start/End: Original strand, 28677536 - 28677698
Alignment:
| Q |
16 |
atgactttgtctctaggacatatgcgtgattaatagtttaatggtagtagcag----ctgaagaagcaagcatccgaggaaccttctaaaacctatgtgt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28677536 |
atgactttgtctctaggacatatgcgtgattaatagtttaatggtagtagcaggcagctgaagaagcaagcatctgaggaaccttctaaaacctatgtgt |
28677635 |
T |
|
| Q |
112 |
gtgcatagaataattgtggatgtgttttattattgagtttaattggaatgcaatattattgta |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28677636 |
gtgcatagaataattgtggatgtgttttattattgagtttaattggtatgcaatattattgta |
28677698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 382
Target Start/End: Original strand, 28677856 - 28677885
Alignment:
| Q |
353 |
gtttctgtgaagaaaaactattttcatctc |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28677856 |
gtttctgtgaagaaaaactattttcatctc |
28677885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University