View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11468_low_16 (Length: 243)
Name: NF11468_low_16
Description: NF11468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11468_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 15179442 - 15179531
Alignment:
| Q |
18 |
caagtgtaacagcaacaatggttgcagttcaattcctagaagtgggtggtaacactctgatcaaagcagccaccaatgatggaatgagta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15179442 |
caagtgtaacagcaacaatggttgcagttcaattcctagaagtgggtggtaacactctgatcaaagcagccaccaatgatggaatgagta |
15179531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 172 - 234
Target Start/End: Original strand, 15179596 - 15179658
Alignment:
| Q |
172 |
ctaccacagaaaaagagcccctccttcaatttcattaccaattttatgtagaatgtttcttct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
15179596 |
ctaccacagaaaaagagcccctccttcaatttcatcatcaattttatgtagaatgtttcttct |
15179658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 15201095 - 15201184
Alignment:
| Q |
18 |
caagtgtaacagcaacaatggttgcagttcaattcctagaagtgggtggtaacactctgatcaaagcagccaccaatgatggaatgagta |
107 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||| | |||||||||||| | ||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
15201095 |
caagtgtaacagcagcaatgattgcagctcaattcgtggaagtgggtggtgatactctaatgaaagcagccaccaaagatggaatgagta |
15201184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 15208167 - 15208256
Alignment:
| Q |
18 |
caagtgtaacagcaacaatggttgcagttcaattcctagaagtgggtggtaacactctgatcaaagcagccaccaatgatggaatgagta |
107 |
Q |
| |
|
||||||||||| |||||||| |||||| |||| || | |||||||||||| | ||||| || ||| ||||||| || ||||||||||||| |
|
|
| T |
15208167 |
caagtgtaacaacaacaatgattgcagctcaaatcgttgaagtgggtggtgaaactctaatgaaatcagccactaaagatggaatgagta |
15208256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University