View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11468_low_19 (Length: 239)
Name: NF11468_low_19
Description: NF11468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11468_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 4 - 224
Target Start/End: Original strand, 1830074 - 1830294
Alignment:
| Q |
4 |
gtccgagccattaagaggtaattaaccaaatctttcttttgttaatgaatttcagtgtttatgttttctttaactttgttatgcattggtgactcaagga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1830074 |
gtccgagccattaagaggtaattaaccaaatctttcttttgttaatgaatttcagtgtttatgttttctttaactttgttatgcattggtgactcaagga |
1830173 |
T |
 |
| Q |
104 |
aaactagttcaagtttttctatttgttattattttctacagacatatctatgcgtttcattttatgattattttgatagtagtgttgcttgttccaaacc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1830174 |
aaactagttcaagtttttctatttgttattattttctacagacatatctatgcgtttcattttatgattattttgatagtagtgttgcttgttccaaacc |
1830273 |
T |
 |
| Q |
204 |
catttggttgacctagtgtgt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1830274 |
catttggttgacctagtgtgt |
1830294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University