View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11468_low_20 (Length: 237)
Name: NF11468_low_20
Description: NF11468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11468_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 42227887 - 42228076
Alignment:
| Q |
20 |
cccccaaaccaccaatacactttatcagtctctttttcttgcaagacttgaagttcaataacatatttttcttagatcaatccaattgtgatgatgtgat |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42227887 |
cccccaaaccaccaatacactttatgagtctctttttcttgcaagacttgaagttcaataacatatttttcttagat---------------gatgtgat |
42227971 |
T |
 |
| Q |
120 |
cttcattcaaagattattttctgggattcattgaaccacatcatcttaaagcaaattattcaattttcaatccaatgataaatggtcgaataatagagtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227972 |
cttcattcaaagattattttctgggattcattgaaccacatcatcttaaagcaaattattcaattttcaatccaatgataaatggtcgaataatagagtg |
42228071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University