View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11468_low_23 (Length: 207)
Name: NF11468_low_23
Description: NF11468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11468_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 37 - 189
Target Start/End: Original strand, 6069612 - 6069765
Alignment:
| Q |
37 |
tcacaataattaaaatttggcgattaagtgaaatggaatatgtataagaactagaagtgcatatttgacnnnnnnn-tcacggcaacttcatgcactttt |
135 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6069612 |
tcacaataattaaaatttggtgattaagtgaaatggaatatgtataagaactagaagcgcatatttgacaaaaaaaatcacggcaacttcatgcactttt |
6069711 |
T |
|
| Q |
136 |
tcctttttatattagtatacgaagactagaaaaatgttctttgaaggtcaattt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6069712 |
tcctttttatattagtatacgaagactagaaaaatgttctttgaaggtcaattt |
6069765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University