View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11469_low_6 (Length: 237)
Name: NF11469_low_6
Description: NF11469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11469_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 15 - 218
Target Start/End: Original strand, 23451219 - 23451422
Alignment:
| Q |
15 |
aattttctgcaatgtttcggaataaattgtagaaaactctgaatatttatgacagagaaaactctaattaagtcttaactttgtgctaaagttctataca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23451219 |
aattttctgcaatgtttcggaataaattgtagaaaactctgaatatttatgacagagaaaactctaattaagtcttaac-ttgtgctaaagttctataca |
23451317 |
T |
 |
| Q |
115 |
tactcaggttaacaagcttctcatttttcatgctttttc-nnnnnnncatatgcaagtgcacaactgactttggctattgaacattttaaatataattcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23451318 |
tactcaggttaacaagcttctcatttttcatgctttttcaaaaaaaacatatgcaagtgcacaactgactttggctattgaacattttaaatataattcc |
23451417 |
T |
 |
| Q |
214 |
cttct |
218 |
Q |
| |
|
||||| |
|
|
| T |
23451418 |
cttct |
23451422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University