View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11470_high_27 (Length: 355)
Name: NF11470_high_27
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11470_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 37339786 - 37339448
Alignment:
| Q |
1 |
aagataaatagcgtctttaaaaaacatgcaggggatatcatatatgacagtgatttgaaactagtcatgaaagacttcaaagttaagcaaaactggccag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37339786 |
aagataaatagcgtctttaaaaaacatgcaggggatatcatatatgacagtgatttgaaattagtcatgaaagacttcaaagttaagcaaaactggccag |
37339687 |
T |
 |
| Q |
101 |
ctagtaagaataattttgcagcatgtctcaaggttattcaaagcatggaatgttgcaattataaattatagnnnnnnnaagtgaaagctactcaagacta |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37339686 |
ctagtaagattaattttgcagcatgtctcaaggttattcaaagcatggaatgttgcaattataaattatagtttttttaagtgaaagctactcaagacta |
37339587 |
T |
 |
| Q |
201 |
aaatatgctcttcagaagtgtacagaaaatcaagaattaaaacaataccatatgtgctatcttcactatccaagttacttttgctgatgaaaggattttc |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37339586 |
aaatatgctcatcagaagtgtacagaaaatcaagaattaaaacaataccatatgtgctatcttcactatccaagttacttttgctgatgaaaggattttc |
37339487 |
T |
 |
| Q |
301 |
aaaagtagcaacagttcttgtatgctgataacataaatc |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37339486 |
aaaagtagcaacagttcttgtatgctgataacataaatc |
37339448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University