View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11470_high_41 (Length: 259)
Name: NF11470_high_41
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11470_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 40 - 229
Target Start/End: Original strand, 43316167 - 43316356
Alignment:
| Q |
40 |
ctaatcttacaacttattacttatattggttttcaaataatttctagtttgaatccaaattaaccaagctagccatatgttggatttctagtagaggttg |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43316167 |
ctaatcttacaacttattacttatattggttttcaaataatttttagtttgaatccaaattaaccaagctagccatatgttggatttctagtagaggttg |
43316266 |
T |
 |
| Q |
140 |
ctagctataacggttgtggtggcatcgcgatcttggtattctagagaatcagggtaaaatattcgaccgatgcatgctcagccgcggttg |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43316267 |
ctagctataacggttatggtggcatcgcgatcttggtattctagagaatcacggtaaaatattcgaccgatgcatgctcagccgcggttg |
43316356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University