View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11470_high_44 (Length: 250)
Name: NF11470_high_44
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11470_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 4 - 142
Target Start/End: Complemental strand, 44625075 - 44624937
Alignment:
| Q |
4 |
catttactaaattgacatcatccttaacatatttcataccacctaaccactaatactaagtgtgtgtttggaaagttggctaactcttaaattaccgcgg |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44625075 |
catttactaaattgacatgatccttaacatatgtcataccacctaaccactaataccaagtgtgtgtttggaaagttggctaactcttaaattaccgcgg |
44624976 |
T |
|
| Q |
104 |
ttttataaaaacaaactagttatatgggtgcatttgatt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44624975 |
ttttataaaaacaaactagttatatgggtgcgtttgatt |
44624937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 23 - 97
Target Start/End: Complemental strand, 44630905 - 44630831
Alignment:
| Q |
23 |
atccttaacatatttcataccacctaaccactaatactaagtgtgtgtttggaaagttggctaactcttaaatta |
97 |
Q |
| |
|
||||||||||||| | | | |||||||| | ||||||||||||| ||||| |||||| ||| ||||||||||||| |
|
|
| T |
44630905 |
atccttaacatatcttacatcacctaacaagtaatactaagtgtatgtttagaaagtcggccaactcttaaatta |
44630831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University